| stri_match_all {stringi} | R Documentation |
These functions extract substrings of str that
match a given regex pattern. Additionally, they extract matches
to every capture group, i.e. to all the subpatterns given
in round parentheses.
stri_match_all(str, ..., regex)
stri_match_first(str, ..., regex)
stri_match_last(str, ..., regex)
stri_match(str, ..., regex, mode = c("first", "all", "last"))
stri_match_all_regex(str, pattern, omit_no_match = FALSE,
cg_missing = NA_character_, ..., opts_regex = NULL)
stri_match_first_regex(str, pattern, cg_missing = NA_character_, ...,
opts_regex = NULL)
stri_match_last_regex(str, pattern, cg_missing = NA_character_, ...,
opts_regex = NULL)
str |
character vector with strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex |
character vector defining regex patterns to search for; for more details refer to stringi-search-regex |
omit_no_match |
single logical value; if |
cg_missing |
single string to be used if a capture group match is unavailable |
opts_regex |
a named list with ICU Regex settings
as generated with |
Vectorized over str and pattern.
If no pattern match is detected and omit_no_match=FALSE,
then NAs are included in the resulting matrix (matrices), see Examples.
Please note: ICU regex engine currently does not support named capture groups.
stri_match, stri_match_all, stri_match_first,
and stri_match_last are convenience functions.
They just call stri_match_*_regex – they have been
provided for consistency with other string searching functions' wrappers,
cf. e.g. stri_extract.
For stri_match_all*,
a list of character matrices is returned. Each list element
represents the results of a separate search scenario.
For stri_match_first* and stri_match_last*,
on the other hand, a character matrix is returned.
Here the search results are provided as separate rows.
The first matrix column gives the whole match. The second one corresponds to the first capture group, the third – the second capture group, and so on.
Other search_extract: stri_extract_all_boundaries,
stri_extract_all,
stringi-search
stri_match_all_regex("breakfast=eggs, lunch=pizza, dessert=icecream",
"(\\w+)=(\\w+)")
stri_match_all_regex(c("breakfast=eggs", "lunch=pizza", "no food here"),
"(\\w+)=(\\w+)")
stri_match_all_regex(c("breakfast=eggs;lunch=pizza",
"breakfast=bacon;lunch=spaghetti", "no food here"),
"(\\w+)=(\\w+)")
stri_match_first_regex(c("breakfast=eggs;lunch=pizza",
"breakfast=bacon;lunch=spaghetti", "no food here"),
"(\\w+)=(\\w+)")
stri_match_last_regex(c("breakfast=eggs;lunch=pizza",
"breakfast=bacon;lunch=spaghetti", "no food here"),
"(\\w+)=(\\w+)")
stri_match_first_regex(c("abcd", ":abcd", ":abcd:"), "^(:)?([^:]*)(:)?$")
stri_match_first_regex(c("abcd", ":abcd", ":abcd:"), "^(:)?([^:]*)(:)?$", cg_missing="")
# Match all the pattern of the form XYX, including overlapping matches:
stri_match_all_regex("ACAGAGACTTTAGATAGAGAAGA", "(?=(([ACGT])[ACGT]\\2))")[[1]][,2]
# Compare the above to:
stri_extract_all_regex("ACAGAGACTTTAGATAGAGAAGA", "([ACGT])[ACGT]\\1")