>Introduction
#Sequin is a program designed to aid in the submission of sequences to
the GenBank, EMBL, and DDBJ sequence databases. It was written at the
National Center for Biotechnology Information, part of the National
Library of Medicine at the National Institutes of Health. This section
of the help document provides a basic overview of how to submit
sequences using the Sequin forms. Subsequent sections provide detailed
instructions for entering information on each form.
*The help documentation
#The Sequin help documentation is available in both on-line and World
Wide Web (http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html) formats.
The text of the on-line version scrolls as you progress through the
Sequin forms. Specific words or phrases can be identified with the
"find" command at the top of the window. The on-line document can also
be saved as a text file, or printed directly to a printer. Click on the
window which contains the help documentation. Under the Sequin File
menu, choose Export Help... to save the documentation as a text file.
To print the documentation without saving it first, click on the help
window, and choose Print from the Sequin File menu.
*Organization of Forms
#Information is entered into Sequin on a number of different forms. Each
form is made up of pages which are indicated by folder tabs at the top
of the form. You can move to the desired page by clicking on the
appropriate folder tab. You can also move between pages of a form by
clicking on the "Next page" or "Prev page" buttons at the bottom of the
screen. You can move to the previous form or the next form by clicking
on the "Prev form" or "Next form" buttons on the first or last pages of
a form, respectively.
#There are two levels of folder tabs. Tabs with large bold lettering
indicate pages which should be filled out for every entry. Tabs with
smaller lighter lettering indicate minor pages which provide access to
infrequently used parameters.
#There are numerous ways to enter information onto a page of a form.
Many of these, such as text fields, radio buttons, check boxes, and
scrolling boxes, are standard in other computer programs and will not be
described here. Sequin does employ two less standard data entry options,
pop-up menus and spreadsheets.
#Pop-up menus: When the mouse is clicked in one of these menus, a list
of choices is displayed. Select the correct option by moving the mouse
to that option and letting go. Only one option can be selected.
#Spreadsheets: These are fields which change their size in response to
the amount of information entered. After you input information into a
field, another field will appear in which you can enter additional
information if necessary.
*Overview of Sequin
#If you are using Sequin for the first time, you will be prompted to
fill out four forms: the Welcome to Sequin form, the Submitting
Authors Form, the Sequence Format form, and the Organism and Sequences
Form. After you have filled out these forms, a window will appear which
contains the Sequin record viewer. This viewer allows you to access many
other forms in which you can edit fields filled out in the three initial
forms, as well as add additional information you feel should be included
in the submission. Detailed instructions on how to fill out the forms
and use the record viewer is presented below.
>Welcome to Sequin Form
#First,
indicate with one of the three radio buttons whether you are submitting the
sequence to the GenBank, EMBL, or DDBJ database. If you are working on a
sequence submission for the first time, click on "Start New Submission." If
you
are modifying an existing submission record, click on "Read Existing Record."
If
you would like to quit from Sequin, click on "Quit Program."
#You can also "Read Existing Record" to read in a FASTA-formatted sequence file
for analysis purposes. The sequence will be displayed in Sequin and can be
analyzed with tools such as CDD BLAST, but it should not be submitted since
it does not have the appropriate annotations.
#If you are running Sequin in its network-aware mode, you will see
another button labelled "Download from Entrez." This option allows you
to update an existing database record using Sequin. The record will be
downloaded from GenBank into Sequin using the NCBI's Entrez retrieval
system. The contents of the record will appear in Sequin, and you can
edit them by updating the sequence or the annotations, as necessary. If
you do not see the button labelled "Download from Entrez" on the Welcome
to Sequin form, you are not running Sequin in its network-aware mode.
To make Sequin network-aware, see the
instructions
later in the help documentation.
#You can update only those records which
you have submitted, not those submitted by others. To update an existing record,
first select which of the databases you will be sending the update to.
This should be the database to which the original record was submitted.
If you do not know which database to use, send the record to GenBank and
the NCBI staff will forward it to the appropriate database. Next, click
on the button "Download from Entrez." Enter the accession number or GI
of the sequence on the first form. Then enter "yes" if you are planning
to submit the record as an update to one of the databases. Fill out the
Submitting Authors form.
Instructions
for this form are found in the Sequin help documentation under "Edit
Submitter Info" under the Sequin File menu. The record will then open
in Sequin. Explanations of how to add annotations or update
sequences are presented in the documentation entitled
"Editing the record"
and
"Sequence Editor"
respectively. You will not see the Submitting Authors Form, the
Sequence Format Form, or the Organism and Sequences Form. Note that
updates, as well as new records, must be emailed to the appropriate
database. Sequin does not support direct submission of records over the
Internet.
#Additional configuration options are available under the Misc menu.
First, you can toggle between the stand-alone and network aware modes of
Sequin. The default mode of Sequin, which is sufficient for most
sequence submissions, is stand-alone. In its network aware mode, Sequin
can exchange data with the NCBI and, for example, retrieve sequences
from Entrez and perform BLAST searches. The network aware mode of
Sequin is described in detail in the
Net Configure
section below. Second, if you are running Sequin in its network aware
mode, you can query NCBI's Entrez database. Further information about
how to query Entrez is
available.
http://www.ncbi.nlm.nih.gov/Entrez.
Third, you can start the NCBI DeskTop. The DeskTop, which is for
advanced Sequin users only, is described
below.
>Submitting Authors Form
#Information from this form will be used as a citation for the sequence
entry itself. It can contain the same information found in citations
associated with the formal publication of the sequence.
#On the bottom of each form are two buttons. Click "Prev form" (first
page in a form) or "Prev page" (subsequent pages in a form) to go to the
previous form or page. Click "Next Form" (last page on a form) or "Next
Page" (earlier pages on a form) to move to the next form or page.
#Form pages can also be saved individually by using the "Export" function
under the File menu. If you are processing multiple submissions, you
can use the "Import" function under the File menu to paste previously
entered information directly on the page.
#The Contact, Authors, and Affiliation pages can be saved as a block so that
you
can use this information for your next submission. For your first Sequin
submission, fill in the requested information on the Submitting Authors form,
and
proceed with the preparation of the submision. In the record viewer, when the
submission is basically finished, click on "Edit Submitter Info" under the Edit
menu. Under the file menu in the resulting Submission Instructions form, click
on Export Submitter Info to save the information to a file. For subsequent
Sequin submissions, if you have already saved the submittor information, click
on
Import Submitter Info under the File menu on the Submission page of the
Submitting Authors form. You must still fill in the manuscript title on the
Submission page though.
*Submission Page
**May we release this record before publication?
#Please select one of the two radio buttons. If you select "Yes," the
entry will be released to the public after the database staff has added
it to the database. If you select "No," fields will appear in which you
can indicate the date on which the sequences should be released to the
public. The submission will then be held back by the database staff
until formal publication of the sequence or GenBank Accession Number, or
until the Release Date, whichever comes first.
**Tentative title for manuscript
#Please enter a title which appropriately describes the sequence entry.
This is a title for the sequence submission, and you may or may not want
it to be the same as the title of an article in which the sequence is
described. Later in the submission process, you will have the
opportunity to change this information and add references from published
or in press works which describe the sequence.
*Contact Page
#Please enter the name, telephone and fax numbers, and e-mail address of
the person who is submitting the sequence. This is the person who will
be contacted regarding the sequence submission. This person does not
have to be on the list of authors involved in the sequencing. The
phone, fax, and e-mail address will not be visible in the database
record.
*Authors Page
#Please enter the names of the people who should receive scientific
credit for the generation of sequences in this entry. The person on the
Contact page is automatically listed as the first author. This
information can be changed if necessary. The author names should be entered
in the order first name, middle initial, surname. You can add as many authors
to this page as you wish. After you type in the name of the third author,
the box becomes a spreadsheet, and you can scroll down to the next line
by using the space bar.
*Affiliation Page
#Please enter information about the principal institution where the
sequencing was performed. This is not necessarily the same as the
workplace of the person described on the Contact page. This information
will show up in the reference section of the record, with the title
Direct Submission.
>Sequence Format Form
#Use this form to indicate the type and format of sequence you are submitting.
#Sequin can process single nuceotide sequences as well as sets of related
sequences. If the sequences are
related in terms of coming from the same publication, or the same organism,
they may be candidates for a Batch submission. Biologically-related sequences
may be classified as environmental samples, polulation, phylogenetic, mutation,
or segmented sets as appropriate. Segmented sets consist of a
collection of non-overlapping sequences covering a specific genetic region. In
all cases, although the sequences are handled as a single submission, each
sequence in a set will receive its own database accession number and can be
annotated independently.
#Sequin can display the alignments of sequences which are submitted as part of
an aligned phylogenetic, population, mutation set or environmental samples. Such
sequences can be
submitted in FASTA, Contiguous (FASTA+GAP, NEXUS, MACAW), or Interleaved
(PHYLIP, NEXUS) formats. If the sequences are in FASTA format, Sequin can
generate an alignment. If the sequences have already been aligned in FASTA+GAP,
PHYLIP, MACAW, or NEXUS, Sequin will not change the alignment. If one of the
sequences in your alignment is already present in the GenBank/EMBL/DDBJ database,
you must mark that sequence so that it does not receive a new accession number.
Instead of supplying that sequence with a new Sequence Identifier, give it
the identifier accU12345, where U12345 is the accession number of the sequence.
#Single sequences, segmented sequences, and batch submissions must be submitted
in FASTA format.
*Submission type
#Use the radio buttons to indicate which of the following type of
submissions you are creating:
#-Single sequence: a single mRNA or genomic DNA sequence. If you are submitting multiple
sequences from the same publication, consider a Batch Submission. If you
decide to submit multiple Sequin files, each with one or more sequences, please
send each file in a separate email message.
#-Segmented sequence: a collection of non-overlapping, non-contiguous sequences
which cover a specified genetic region. A standard example is a set of genomic
DNA sequences which encode exons from a gene along with fragments of their flanking
introns. If the segmented set is part of an alignment, however, select the appropriate
Population, Phylogenetic, or Mutation study button.
#-Population study: a set of sequences which were derived by sequencing the same
gene from different isolates of the same organism.
#-Phylogenetic study: a set of sequences which
were derived by sequencing the same gene from different organisms.
#-Mutation study: a set of sequences which were
derived by sequencing multiple mutations of a single gene.
#-Environmental samples: a set of sequences which were derived by sequencing the
same gene from a population of unclassified or unknown organisms.
#-Batch submission: a set of related
sequences which are not part of a population, mutation, or phylogenetic study.
The sequences should be related in some way, such as coming from the same
publication or organism. You should plan that all sequences will be released
to the public on the same date.
*Sequence data format
#Use the radio buttons to select one of the data formats. If you are
submitting a single or segmented sequence, or a batch submission, your
sequence must be in FASTA format, described below. If you are
submitting a set of sequences as part of a population, phylogenetic, or
mutation study, you have a choice of sequence formats. You may submit
the set as individual sequences in FASTA format. However, if your
sequences are already aligned, you can submit the sequences as part of
an alignment. Sequin currently accepts the alignment formats FASTA+GAP,
PHYLIP, MACAW, NEXUS Interleaved, and NEXUS Contiguous. All formats are
described in the
Nucleotide Page
, below.
>Organism and Sequences Form
#This form is made up of three pages. On the Organism
page, you indicate the organism from which the sequence derives.
However, as explained below, in the case of a set of sequences submitted
as part of a phylogenetic study, the organism is indicated either in the
sequence file itself or on the following
Source Modifiers
form. The second
page, the Nucleotide page, prompts you to import the nucleotide
sequence(s) into Sequin from a separate file. The identity of
the third page changes depending on the submission type indicated on the
previous Sequence Format page. If you are submitting a single or
segmented sequence, this page is a Protein page, which prompts you to
import the relevant amino acid sequence. If you are
submitting a population, phylogenetic, or mutation study, this page is
an Annotation page, which allows you to add certain annotations to your
nucleotide sequence.
*Organism Page
#Information about the organism from which the sequence was derived
should be entered on this page. Alternatively, for any type of
submission, the name of the organism, as well as additional information,
can be indicated instead in the file which contains the nucleotide
sequence. Indeed, if you are submitting a set of sequences for a
phylogenetic study, you will not be able to fill out any information on
the Organism page. Instead, you must indicate the organism names in the
sequence file or on the following
Source Modifiers
form. A detailed description of how to format this organism
information is presented in the documentation for the
Nucleotide Page
, below.
**Organism
#The scrollable list contains the scientific names of many organisms.
To reach a name on the list, type the first few letters of the
scientific name into the appropriate field. The list will scroll to the
appropriate place, and you can select the organism. When you choose a
name from the list, the Scientific Name and the Genetic Code for
Translation fields are filled out automatically. If there is a common
name for the organism, the Common Name field will be filled out as well.
You can also use the space bar to reach the appropriate part of the
list. If you have any questions about the scientific or common name of
an organism, see the NCBI
taxonomy browser
http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
#If the name of the organism is not on the list, type it in directly. If you do
not know the scientific name, please be as specific as you can, and include a
unique identifier, such as a clone, isolate, strain or voucher number or
cultivar name, e.g.: Nostoc ATCC29106, uncultured spirochete Im403, Lauraceae
sp. Vásquez 25230 (MO), Rosa hybrid cultivar 'Kazanlik'. Also, if applicable,
indicate if the name is unpublished as of time of submission. Additional
information like subspecies, strain, isolates, or serotype can be entered later
in the submission process.
**Location of Sequence
#From the selection list, please enter the location of the genome which
contains your sequence. Most entries will have a "Genomic" location.
The following is a brief description of the choices in this pop-up menu:
#-Genomic: chromosome. This category includes
mitochondrial and chloroplast proteins which are encoded by the nuclear
genome.
#-Chloroplast: a chlorophyllous plastid.
#-Chromoplast: a non-chlorophyllous, pigmented plastid, found in
fruits and flowers.
#-Kinetoplast: a specialized type of mitochondrion found exclusively
in Kinetoplastida (e.g., Leishmania). NOTE: 'kinetoplast' should
be applied ONLY to members of the Kinetoplastida (trypanosomes and
bodonids).
#-Mitochondrion: a semi-autonomous, self-reproducing organelle that
occurs in the cytoplasm of most eukaryotic cells
#-Plastid: any of a class of double membrane-bound, light-harvesting
organelles (or derived from same). NOTE: 'plastid' should be used
ONLY when a more precise term, e.g., chloroplast, is not
applicable.
#-Macronuclear: a specialized type of nucleus found exclusively in the
ciliated protists (e.g., Tetrahymena). NOTE: 'macronucleus'
should be applied ONLY to members of the Ciliophora.
#-Extrachromosomal: other extrachromosomal
elements not listed here, such as a B chromosome or an F factor.
#-Plasmid: extrachromosomal genetic element found in bacterial species.
Note this does not include the cloning vector used to propagate
the sequence of interest.
#-Transposon: transposable element flanked by repeat sequences containing
genes in addition to those needed for insertion
#-Insertion sequence: simple transposable element carrying repeat sequences
containing a transposase gene
#-Cyanelle: a specialized type of plastid found exclusively in
glaucocystophytes (e.g., Cyanophora). NOTE: 'cyanelle' should be
applied ONLY to members of the Glaucocystophyceae.
#-Proviral: a virus that is integrated into a host cell chromosome
#-Virion: a completed virus particle
#-Nucleomorph: a reduced nuclear remnant found in Chlorarachniophyceae
(e.g., Chlorarachnion) and Cryptophyta (e.g, Cryptomonas). NOTE:
'nucleomorph' should be applied ONLY to members of the
Chlorarachniophyceae or Cryptophyta.
#-Apicoplast: a reduced plastid characteristic of apicomplexans
(e.g., Plasmodium). NOTE: 'apicoplast' should be applied ONLY to
members of the Apicomplexa.
#-Leucoplast: a plastid lacking pigments of any type.
#-Proplastid: an immature plastid.
#-Endogenous_virus: a virus that has integrated permanently into the
host genome, and which is inherited vertically through the
germ-line of the host.
**Genetic Code for Translation:
#If the submission type was Phylogenetic study, this field will read
"Default Genetic Code." Please use this field to select the genetic
code which should be used to translate the nucleic acid sequence. The
genetic code for a eukaryotic organism is "Standard". If you selected a
scientific organism name from the scrollable list described
above, this field was filled out automatically. If you encode the
organism name directly in the first line of the file which contains your
sequence, Sequin will fill out this field automatically after your
sequence is imported. However, if the organism is
not among the top 500 organisms represented in GenBank, this field will
not be filled out automatically, and you must select the genetic code.
#For more information regarding the translation tables available, see the NCBI
taxonomy page
.
http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c
*Nucleotide Page
#The nucleotide sequence(s) and associated descriptive information are
entered on this page. Sequin can also interpret the name of the
organism, strain, chromosome, and many other modifiers which are encoded
on the first line of the file which contains the nucleotide sequence.
#If you are submitting sequences as part of a phylogenetic, mutation,
population study, or environmental samples set, you may indicate the organism, strain, chromosome, and
other modifiers in one of two places. This information can be encoded
in the file which contains the sequence. Alternatively, you can enter
the information on the
Source Modifiers form
which follows the Organism and Sequences Form.
#If you are submitting a set of aligned sequences, and one of those
sequences is already present in the GenBank/EMBL/DDBJ database, you must
mark that sequence so that it does not receive a new accession number.
Instead of supplying that sequence with a new Sequence Identifier, give
it the identifier accU12345, where U12345 is the accession number of the
sequence.
**Molecule
#A database sequence can represent one of several different molecule
types. Enter in the Molecule pop-up menu the type of molecule that was
sequenced.
#-Genomic DNA: Sequence derived directly from the DNA of an organism.
Note: The DNA sequence of an rRNA gene has this molecule type.
#-Genomic RNA: Sequence derived directly from the genomic RNA of certain
organisms, such a viruses.
#-Precursor RNA: An RNA transcript before it is processed into mRNA,
rRNA, tRNA, or other cellular RNA species.
#-mRNA[cDNA]: A cDNA sequence derived from mRNA.
#-Ribosomal RNA: A sequence derived from the RNA in ribosomes, for
example, the sequence of a cDNA derived from rRNA.
#-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for
example, the sequence of a cDNA derived from tRNA.
#-Small nuclear RNA: A sequence derived from small nuclear RNA, for
example, the sequence of a cDNA derived from snRNA.
#-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA,
for example, the sequence of a cDNA derived from small cytoplasmic RNA.
#-Other-Genetic [plasmid]: A sequence that is not normal genetic
material but that is also is not a transcription product. Examples
include plasmids, B chromosomes, and F factors.
**Topology
#Please choose the topology of the molecule, either Linear or Circular,
from the pop-up menu. Most sequences have linear topology. Select
Circular if the sequence is complete and it has a circular topology, for
example, it is a plasmid or a complete mitochondrial genome.
**Incomplete at 5' end/Incomplete at 3' end
#If the sequence is incomplete at the 5' or 3' end, please check the
appropriate box. If a complete sequence is entered, for example, the
complete coding sequence of a gene, do not check either box.
**FASTA def line starts with sequence ID
#This box will not be visible if you selected
Interleaved or Contiguous format on the Sequence Format form.
#We suggest that for standard simple submissions you follow the
instructions below for how to create a nucleotide sequence in FASTA
format. In FASTA format, the line preceding the lines of sequence
consists of a ">" sign, followed by some descriptive information. If
you follow the instructions, and the line immediately above your
sequence reads
#>SeqID [org=organism scientific name] title
#check this box. The unique sequence identifier for the sequence will
be the word which immediately follows the ">".
#If you have not included a SeqID, leave this box unchecked, and Sequin
itself will assign a unique sequence identifier. However, be sure that
the first line of descriptive information starts with a ">".
**FASTA format for nucleotide sequences
#The sequence(s) which you will be submitting should be located in
another file; you cannot directly type sequence data
into this page. The sequence(s) must be in a certain format, called the
FASTA format. Each line of sequence should be no longer than 80
characters.
#Note: If you are submitting multiple sequences as part of a
phylogenetic, population, mutation study, or environmental samples set, each sequence must be in
FASTA format. However, it does not matter if the sequences are in one
file or separate files on your computer. You can encode information
about the sequence, such as the organism, chromosome, or strain, in the
file that contains the sequence, as described below. Alternatively,
this information can be added on the
Source Modifiers form
which follows the Organism and Sequences Form.
#The line directly above the sequence (the first line in the
file, for a single sequence) should read
#>SeqID [org=organism scientific name] [modifier=modifier name] title
#for example,
!>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Human breast and
ovarian cancer susceptibility (BRCA1) mRNA, complete cds.
#->: The ">" sign must precede any descriptive information about your
sequence. Any line which does not begin with a ">" sign will be
interpreted as a line of nucleotide sequence.
#-SeqID: A unique sequence identifier which you give your sequence.
This field is required only if you have checked the box on the
Nucleotide page entitled "FASTA def line starts with sequence ID." This
name must be different from the name which you give to other nucleotide
or protein sequence(s). If you do not include an identifier here, Sequin
will create one for you. The identifier will be changed to an accession
number by the database staff later in the submission process. If you
are submitting a set of aligned sequences, and one of those sequences is
already present in the GenBank/EMBL/DDBJ database, you must mark that
sequence so that it does not receive a new accession number. Instead of
supplying that sequence with a new SeqId, give it the identifier
accU12345, where U12345 is the accession number of the sequence.
#-[org=organism scientific name]: This field gives you the opportunity
to indicate the name of the organism directly on the sequence file. You
must indicate the name of the organism here if you are submitting
sequences as part of a phylogenetic study. For other types of
submissions, you may indicate the organism name either with this field
or by filling out the previous Organism page. You must enter the
complete scientific name (no abbreviations). The field must be written
as shown, complete with brackets. Do not put spaces around the "=".
Some common examples include [org=Homo sapiens], [org=Mus musculus],
[org=Saccharomyces cerevisiae], and [org=Drosophila melanogaster]. The
NCBI maintains a
taxonomy database
with information about scientific and common organism names
http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
#-[modifier=modifier name]: Additional modifiers can also be encoded on the
first line of the nucleotide sequence. These modifiers include moltype,
molecule, chromosome, map, clone, tissue-type, strain,
and specimen-voucher. A complete list and descriptions of these modifiers
can be found in the
Source
and
Organism
subpages of the Biological Source Modifiers page. You may include as
many modifiers as you like, but each must be bounded by a set of
brackets. The name of the modifier must be written exactly as shown in
the list above. An example of a string of modifiers is [strain=BALB/c]
[chromosome=5] [sex=male] [tissue-type=testis][moltype=mRNA]. Modifiers can
also be
added as
Biological Source
descriptors or features later in the submission process.
#-[lineage=lineage]: If you are working with an organism whose lineage is not
listed in the NCBI taxonomy database, you can provide the complete lineage
here.
#-title: A definition or description of the sequence.
Sequin can create titles automatically, using the Generate
Definition Line function under the
Annotate
menu. Titles can be edited later in the submission process by
selecting Descriptors-->Title, under the Annotate menu in the
record viewer,
described
below.
Choose the title carefully, as it will become the Definition line of
your submission. If you are submitting a set of sequences from a
phylogenetic, population, mutation study, or environmental samples set, you can leave this field
blank. You can instead add the sequence titles on the
Annotation
page below.
**Nucleotide Definition line (title)
#Nucleotide definition lines, or titles, follow a structured format.
For an entry which includes a coding region, the definition would
be in the format:
#Genus species Protein name (gene symbol) mRNA/gene,
complete/partial cds
#However, the general format does not cover all possible Definition
lines, as shown in the following examples:
!-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.
!-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) gene, exon 4.
!-Gallus gallus red-sensitive pigment mRNA, complete cds.
!-Bos taurus retinal pigment (RPE1) mRNA, 3' UTR.
!-Saccharomyces cerevisiae cystathionine gamma-lyase (CYS3) gene, complete cds.
!-Arabidopsis thaliana pyruvate dehydrogenase E1 alpha subunit mRNA, nuclear
gene for mitochondrial product, complete cds.
!-Homo sapiens Down syndrome region, chromosome 13, genomic sequence.
!Ophraella conferta isolate 62 16S ribosomal RNA gene,
mitochondrial gene for mitochondrial product.
**Example of the first line of a nucleotide FASTA sequence
!>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Homo sapiens breast and
ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.
**FASTA+GAP format for aligned nucleotide sequences
#A number of programs output sets of aligned sequences in FASTA format.
Frequently, in order to align these sequences, gaps must be inserted.
In FASTA+GAP format, gaps can be indicated by a "-". Do not use the ? character to represent
ambiguous bases within sequences in the alignment since Sequin
removes non-IUPAC characters when it imports sequences. Each sequence,
including gaps, must be the same length. The gaps will only show up in
the alignment, not in the individual sequence in the database.
#Sequences in FASTA+GAP format resemble FASTA sequences. The previous section
on
FASTA format for nucleotide sequences
has instructions for formatting FASTA sequences. All sequences in
FASTA+GAP format should be in the same file.
#The following is an example of FASTA+GAP format:
!>A-0V-1-A [org=Gallus gallus] [strain=C]
!TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!>A-0V-2-A [org=Drosophila melanogaster] [strain=D]
!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!>A-0V-3-A [org=Caenorhabditis elegans] [strain=E]
!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!>A-0V-4-A [org=Rattus norvegicus] [strain=F]
!TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!>A-0V-7-A [org=Aspergillus nidulans] [strain=G]
!TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
**PHYLIP format for aligned nucleotide sequences
#A number of programs output sets of aligned sequences in PHYLIP format.
#The following is an example of PHYLIP format.
! 5 100
!A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
!A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
!
!
! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
#In this example, the first line indicates that there are 5 sequences,
each with 100 nt of sequence. The following five lines contain the
Sequence IDs, followed by the sequences. Specifically, the sequence
identifier for the first sequence is A-0V-1-A. Note that subsequent
blocks of sequence do not contain the Sequence ID.
#Do not use the ? character to represent
ambiguous bases within sequences in the alignment since Sequin
removes non-IUPAC characters when it imports sequences. Ambiguous bases should
be indicated as IUPAC characters such as N. PHYLIP files should contain - rather
than ? to indicate "missing" at the 5' and 3' ends of sequences.
#You can modify this format so that Sequin can
determine the correct organism and any other modifiers for each
sequence. An example of such modifications are below in the section on
Source Modifiers for PHYLIP and NEXUS
.
#Alternatively, you can leave your sequence alignment in
standard PHYLIP format and enter the organism, strain, chromosome, etc.
information on the following
Source Modifers form
.
**NEXUS format for aligned nucleotide sequences
#A number of programs output sets of aligned sequences in one of two
NEXUS formats, NEXUS Interleaved and NEXUS Contiguous.
#For alignment formats, such as NEXUS, do not use the ? character to represent
ambiguous bases within sequences in the alignment. This is because Sequin
removes non-IUPAC characters when it imports sequences. Ambiguous bases should
be indicated as IUPAC characters such as N.
#NEXUS files can contain ? for "missing" at the 5' and 3' ends of sequences.
#The following is an example of NEXUS Interleaved format.
!#NEXUS
!
![!This data assembled using Sequencher*, from Gene Codes Corporation.]
!begin data;
! dimensions ntax=5 nchar=100;
! format datatype=dna gap=: interleave;
! matrix
!
!A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
!A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA
!A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
!
!
!A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
!A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
!A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
!A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
!A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
#In this example, the first few lines provide information about the data
in the sequence alignment. The following five lines contain the
Sequence IDs, followed by the sequences. Specifically, the sequence
identifier for the first sequence is A-0V-1-A. Note that subsequent
blocks of sequence also contain the Sequence ID.
#The following is an example of NEXUS Contiguous format.
!#NEXUS
!BEGIN DATA;
!DIMENSIONS NTAX=5 NCHAR=100;
!FORMAT MISSING=? GAP=- DATATYPE=DNA ;
!MATRIX
!
!A-0V-1-A
!TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!A-0V-2-A
!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!A-0V-3-A
!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!A-0V-4-A
!TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!
!A-0V-7-A
!TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
#In this example, the first few lines provide information about the data
in the sequence alignment. The following five lines contain the
Sequence IDs, followed by the sequences. Specifically, the sequence
identifier for the first sequence is A-0V-1-A. Note that subsequent
blocks of sequence also contain the Sequence ID.
#You can modify either NEXUS format so that Sequin can
determine the correct organism and any other modifiers for each
sequence. An example of such modifications are below in the section on
Source Modifiers for PHYLIP and NEXUS
.
Alternatively, you can leave your sequence alignment in
standard NEXUS format and enter the organism, strain, chromosome, etc.
information on the following
Source Modifers form
.
**Source Modifiers for PHYLIP and NEXUS
#You can modify the PHYLIP or NEXUS formats so that Sequin can
determine the correct organism and any other modifiers for each
sequence by adding lines at
the end of the file. The first line applies to the
first sequence, the second line to the second sequence, and so on. You
must have one line for each sequence. These inserted lines resemble the
line that immediately precedes the sequence in a FASTA file
except these lines should not begin with a Sequence ID.
Instead, the Sequence ID is present at the beginning of the
sequence lines as shown above.
#Each of the initial lines starts with the character ">". The
scientific organism name follows in brackets. Optional modifiers also
follow in brackets. You can add individual sequence titles on these
lines or you can add the same title to all sequences on the Annotation
page. For further information on the data that can go in the lines
preceding the sequences, see the instructions entitled "FASTA format for
nucleotide sequences",
above.
For instructions on formatting a sequence title, see Nucleotide
Definition line (title),
above.
#The following lines indicating the organims and strain of each sequence
would follow immediately after the sequence in the PHYLIP and NEXUS
examples, above.
!>[org=Gallus gallus] [strain=C]
!>[org=Drosophila melanogaster] [strain=D]
!>[org=Caenorhabditis elegans] [strain=E]
!>[org=Rattus norvegicus] [strain=F]
!>[org=Aspergillus nidulans] [strain=G]
#Alternatively, you can leave your sequence alignment in
standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc.
information on the following
Source Modifers form
.
**Importing aligned sets of segmented sequences
#Sequin can also read segmented sets which are part of an alignment if the
sequences are in FASTA or FASTA+GAP format. Each segment should have its own
Sequence ID, but organism name
and source modifiers should only be indicated for the first segment from each
sequence. Square brackets are used to delimit the members of a set. For
example,
![
!>A-0V-1-Apart1 [org=Gallus gallus] [strain=C]
!TCACTCTTTGGCAAC
!>A-0V-1-Apart2
!GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!]
![
!>A-0V-2-Apart1 [org=Drosophila melanogaster] [strain=D]
!TCACTCTTTGGCAAC
!>A-0V-2-Apart2
!GAAGCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
!]
#If the sequence is in FASTA+GAP format, Sequin will keep the alignment
provided.
However, if the sequence is in FASTA format, you must click on the Create
Alignment button in order to make Sequin generate the alignment.
**To import a nucleotide sequence into Sequin
#After your sequence is in the appropriate FASTA or PHYLIP format, click
on "Import Nucleotide FASTA" or "Import Nucleotide PHYLIP". A new
window will open showing available directories and files. Select the
file containing your sequence and click OK.
If you have imported the wrong sequence, select
Clear under the Edit menu to remove the sequence.
#After you import your sequence, a box will appear with information
about the sequence. The first line will describe the number of
nucleotide segments imported, and the total length in
nucleotides of the sequence. Each segment is numbered, and
its length, unique identifier (SeqID), and title (Definition line) are
listed. If any of this information is missing, check the file
containing the sequence and re-import the sequence.
**To import a set of nucleotide sequences into Sequin
#Sets of FASTA-formatted nucleotide sequences can be imported into
Sequin in one of two ways. If all the sequences are in the same file,
import the file by clicking on "Import Nucleotide FASTA." If the
sequences are in separate files, import them sequentially by clicking on
"Import Nucleotide FASTA." In either case, the line immediately
preceding each sequence must follow the FASTA format described above.
*Protein Page
#Note: This page is for adding protein sequence to a single or
segmented sequence. If you submitted a set of nucleotide sequences from
a population, phylogenetic, or mutation study, this page will be instead
called
Annotation Page
, and is described below.
#This page allows you to provide the protein sequence
translated from the nucleotide sequence which you just entered. If the
nucleotide sequence is alternatively spliced or contains multiple open
reading frames, enter all of the protein sequences on this page. Each
protein sequence will appear in the database record as a coding sequence
(CDS) feature. Sequin will automatically determine which nucleotide
sequences code for the protein, and indicate the nucleotide sequence
interval on the database record. Sequin also provides tools which allow
you to view a graphical representation of all the open reading frames in
your nucleotide sequence, and to convert these reading frames into CDS
features. These tools are described later in the help documentation
under the
ORF Finder.
**Conceptual translation confirmed by peptide sequencing
#Most protein entries are computer-generated conceptual translations of
a nucleic acid sequence. If you have confirmed this translation by
direct sequencing either of the entire protein or of peptides derived
from the protein, please check this box.
**Incomplete at NH3 end/Incomplete at CO2 end
#If the sequence is lacking amino acids at the amino- or
carboxy-terminal end of the protein, please check the appropriate box.
**FASTA def line starts with sequence ID
#We suggest that for standard simple submissions you follow the
instructions below for how to create a protein sequence in FASTA format.
In FASTA format, the line preceding the lines of sequence consists of a
">" sign, followed by some descriptive information. If you follow the
instructions, and the line immediately above your sequence reads
#>SeqID [gene=locus;description] [prot=name;description] title
#check this box. The unique sequence identifier for the sequence will
be the word following the ">" sign.
#If you have not included a SeqID, leave this box unchecked, and Sequin
will assign a unique sequence identifier. However, be sure that
the first line of descriptive information starts with a ">".
**Create initial mRNA with CDS intervals
#If you check this box, Sequin will make an mRNA feature with the same
initial intervals (i.e., range of sequence) as the CDS feature. After
the record has been assembled, you should edit the mRNA feature location
to add the 5' UTR and 3' UTR intervals. This may be done either in the
mRNA editor or in the sequence editor.
**FASTA format for protein sequences
#This amino acid sequence should be located in a file since
you cannot directly type sequence data into this form. It
must be in a certain format, called the FASTA format. If you are
submitting multiple sequences, each one must be in FASTA format. Each
line of sequence should be no longer than 80 characters. Remove any
symbols for stop codons, such as "Z" or "*", from your sequence before
importing it into Sequin. The line directly above the sequence (the
first line in the file, for a single sequence) should read:
#>SeqID [gene=locus;description] [prot=name;description] [comment=text] title
#for example,
!>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility protein]
Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) protein, complete
sequence.
#->: The ">" sign must precede any descriptive information about your
sequence. Any line which does not begin with a ">" sign will be
interpreted as a line of protein sequence.
#-SeqID: A unique sequence identifier which you give your sequence.
This field is required only if you have checked the box on the Protein
page entitled "FASTA def line starts with sequence ID." This name must
be different from the name which you give to other nucleotide or protein
sequences. If you do not include an identifier here, Sequin will
create one for you. The identifier will be changed to an accession
number by the database staff later in the submission process.
#-[gene=gene locus]: Enter [gene=gene locus]. Do not put spaces
around the "=". The brackets are required. An example is [gene=eIF4E].
#-[prot=protein name]: Enter [prot=protein name]. Do not put spaces
around the "=". The brackets are required. An example is
[prot=eukaryotic initiation factor 4E-I].
#-[comment=text]: Enter [comment=text]. Do not put spaces around the
"=". This field is optional. Any text that is entered will become a
/note on the CDS feature (protein sequence).
#-title: A definition or description of the sequence.
If you do not enter a title, Sequin
will create one based on information you have provided. The database
staff will amend it if necessary.
#The protein name should be included in the entry; all other fields are
optional.
**Protein Definition line (title)
#Protein definition lines, or titles, follow a structured format:
#Genus species Protein name (gene name) protein,
complete/partial sequence.
#Use the name in the format of Genus species.
Choose complete or partial depending whether the sequence is
complete or partial.
#However, the general format does not cover all possible Definition
lines, as shown in the following examples:
!-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) protein, complete
sequence.
!-Gallus gallus red-sensitive pigment protein, complete sequence.
!-Bos taurus retinal pigment (RPE1) protein, partial sequence .
!-Saccharomyces cerevisiae cystathionine gamma-lyase (CYS3) protein, complete
sequence.
!-Arabidopsis thaliana pyruvate dehydrogenase E1 alpha subunit protein,
complete sequence, mitochondrial gene for mitochondrial protein.
**Example of the first line of a protein FASTA sequence:
!>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility protein]
Human breast and ovarian cancer susceptibility protein (BRCA1) protein, complete
sequence.
**To import a protein sequence into Sequin
#Click on "Import Protein FASTA." A new window will open showing
available directories and files. Once a filename is selected, click OK.
If you have imported the
wrong sequence, select Clear under the Edit menu to remove the sequence.
#After you import your sequence, a box will appear with information
about the sequence. The first line will describe the number of protein
sequences imported and the total length in amino acids of
the sequence. Each sequence is numbered, and its length,
unique identifier (SeqID), Gene name, Protein name, and title
(Definition line) are listed. If any of this information is missing,
check the file containing the sequence and re-import the sequence.
**To import a set of protein sequences into Sequin
#You may want to import a non-contiguous set of protein sequences into
Sequin if, for example, you are submitting a nucleotide sequence with
multiple open reading frames. Sets of protein sequences can be imported
into Sequin in one of two ways. If all the sequences are in the same
file, import the file by clicking on "Import Protein FASTA." If the
sequences are in separate files, import them sequentially by clicking on
"Import Protein FASTA." In either case, the line immediately preceding
each sequence must follow the FASTA format described above.
*Sequence Import Check Window
#After you import protein sequence(s), a new window will appear in which
you can edit information about the protein sequence. If you did not
enter a unique identifier (SeqID) for the sequence, Sequin generated one
automatically. The SeqID and protein name should be filled out, but the
protein name can also be modified later in the submission process.
Entering other information is optional.
*Annotation Page
#Note: This page is for adding annotations to sets of sequences from
phylogenetic, population, mutation, or environmental samples set. If you submitted a
single or segmented sequence, this page will be instead called
Protein page
, and is described above.
**Adding Gene, rRNA and CDS features to a set of sequences
#The radio buttons at the top of the page allow you to choose which feature(s)
to add to your sequences. Any annotation you add on this page will be
propagated to ALL sequences in the set, and will apply over the full length of
each sequence. If you want to add annotations only to selected sequences, you
must add them manually later in the submission process. You may only select
one of these buttons.
#-Gene: Select Gene to add a gene feature to all sequences in the set. Once
you mark the radio button, additional input lines will be displayed on the
form. If the gene is longer than the sequences in the submission, check
Incomplete at 5' end or Incomplete at 3' end, or both. Enter the gene symbol,
and a comment if necessary.
#-rRNA: Select rRNA if you want to add an rRNA feature to all sequences in the
set. This rRNA will span the entire sequence, from the first nucleotide to the
last. Once you mark the radio button, additional input lines will be displayed
on the form. If the sequence does not encode a complete rRNA molecule, check
Incomplete at 5' end or Incomplete at 3' end, or both. Enter the name of the
rRNA, such as 16s ribosomal RNA. The gene symbol box will be filled in automatically if
you annotated a Gene feature. The comment box allows you to enter any
additional comments about the rRNA.
#-CDS: Select CDS if you want to add a coding sequence (amino acid
translation) to all the sequences in the set. Sequin will automatically
determine the CDS by selecting the longest open reading frame in the
sequences. If your sequence contains multiple open reading frames, or
if the desired open reading frame is not the longest, you can edit the
CDS feature later in the submission process by using the
Coding Region
feature form. Once you mark the radio button, additional input lines
will be displayed on the form. We encourage you to fill in the protein
and gene locus fields. Entering information in the comment box is
optional.
#-None: Select none if you do not want to add a rRNA or CDS feature to
all sequences in the set.
**Adding a title to a set of sequences
#This box allows you to add a title to each sequence in the set. Note
that the identical title will be added to all sequences. You do not
need to add a title here if you already included one in the
FASTA format. A detailed
description
of the title formats preferred by the databases is provided on the
Nucleotide page, above.
#Titles should always start with the name of the organism. If all the
sequences are from the same organism, incorporate the organism name
directly into the title. However, if you are submitting sequences which
derive from different organisms, for example, a phylogenetic study, do
not include the organism names in the title. Instead, check the box
marked "Prefix title with organism name", and Sequin will add the
appropriate organism name to the title for each sequence.
#Sequin will also create titles automatically, using the Generate Definition
Line
function under the
Annotate
menu. In addition, titles can be edited later in the submission process by
selecting Descriptor-->Title, under the Annotate menu in the record viewer,
described
below.
>Source Modifiers Form
#You will only see this form if you are submitting sequences as part of
a phylogenetic, mutation, population study, environmental samples set,
or as a batch submission.
#This form allows you to add or modify necessary information, such as
the organism, and optional information, such as strain or chromosome, for
your sequences. From the top pop-up menu, choose the modifier you want
to annotate. The left column lists the sequences by their SeqID, or the
unique identifier which you (or Sequin) provided for your sequence. Type
the modifier for each sequence in the corresponding box labelled Value.
For example, if you select the Organism modifier, you might type Mus
musculus in the first Value box, Homo sapiens in the second, etc.
#If you have not already supplied the scientific name of the organism,
enter it on this form. Do not use abbreviations.
#Complete descriptions
of these modifiers can be found in the
Source
and
Organism
subpages of the Biological Source Modifiers page. You may add as many
modifiers as you wish.
>Editing the Record
*Overview
#After you finish the Organism and Sequences Form, Sequin will process
your entry based on the information you have entered. The window you
see now is called the record viewer. This is also the window you will
see if you are submitting an update to an existing record. The
instructions after this point are the same whether you are submitting a
new record or an update.
#In the default window of the record viewer, you will see your entry
approximately as it would appear in the database. Most of the
information which you entered earlier in the submission process is
present in the viewer; other information, such as the contact, is still
present in the record but will not be visible in the database entry. If
you have provided a conceptual translation of the nucleotide sequence,
the translation will be listed as a CDS Feature. Sequin automatically
determines which nucleotides encode for the protein, and lists them,
even if the nucleotide sequence contains introns and exons.
#You can save the entry to a file by selecting Save or Save As under the
File menu. This is not the same as saving the entry for submission to
the database. It is a good idea to save the file at this point so that
if you make any unwanted changes during the editing process you can
revert to the original copy. If you wish to edit the entry later, click
on "Read existing Submission" on the Welcome to Sequin form and choose
the file.
#It is likely that the entry could be processed now for submission to
the database. However, you may wish to add information to
the entry. This information may be in the form of Descriptors or
Features. In general, Descriptors are annotations which apply to an
entire sequence, or an entire set of sequences, and Features are
annotations that apply to a specific sequence interval. For example,
you may want to change the Reference Descriptor to add a published
manuscript, or to annotate the sequence by adding features such as a
signal peptide or poly A signal.
#Information in the record viewer can be edited in different ways. One
way to add or modify information is to double click within the block of
information you wish to edit. Many blocks, such as "Definition,"
"Source," "Reference," or "Features" can be edited. For
example, if you wish to add another reference for the sequence, double
click on "Reference" to access the appropriate form.
#A second way to add or modify information is to create a new descriptor
or feature by selecting the appropriate form from the Misc or Features
menus. These options are described later in this help document.
#Finally, you may need to edit the sequence itself.
Instructions
for working with the sequence are presented in the documentation for the
Sequence Editor.
*Submitting the finished record to the database
#Once you are satisfied that you have added all the appropriate
information, you must process your entry for submission to the database.
Select "Validate" under the Search menu. This function detects
discrepancies between the format of your submission and that required by
the database selected for entry.
#If Sequin detects problems with the format of your record, you will see a
screen listing the validation errors as well as suggestions for how to fix the
discrepancies. Single clicking on an error message scrolls the record viewer
to the feature that is causing the error. Double clicking on the error message
launches a new form on which you can enter information to correct the problem.
If you are annotating a set of multiple sequences, shift-click to scroll to the
target sequence and feature. You can also dismiss the suggestion and proceed
on your own. When you think you have corrected all the problems, click on
"Revalidate."
#Message: Select Verbose, Normal, or Terse. Verbose gives a more detailed
explanation of the problem.
#Filter: Select the error messages you wish to see. You can select ALL,
SEQ_INST (errors regarding the sequence itself, its type, or length), SEQ_DESCR
(descriptor errors), SEQ_FEAT (feature errors), or errors specific to your
record.
#Severity: Select the types of error messages you wish to see. You
will see the type of message selected, as well as any messages warning
of more serious problems.
#There are four types of error messages, Info, Warning, Error, and Reject.
Info is the least severe, and Reject is the most severe. You may
submit the record even if it does contain errors. However, we encourage
you to fix as many problems as possible. Note that some messages may be
merely suggestions, not discrepancies. A possible Warning message is
that a splice site does not match the consensus. This may be a
legitimate result, but you may wish to recheck the sequence. A possible
Error message is that the conceptual translation of the sequence which
you supplied does not encode an open reading frame. In this case, you
should check that you translated the sequence in the correct
reading frame. A possible Reject message is that you neglected to
include the name of the organism from which the sequence derives. The
name of the organism is absolutely required for a database entry.
#If Sequin does not detect any problems with the format of your record, you
will see a message that "Validation test succeeded." Click the "Done"
button on the submission viewer, or select "Prepare Submission" under
the File menu. You will be prompted to save the file. E-mail this file
to the database at the address shown. You MUST e-mail the file; Sequin
does not submit the file automatically over the network. The e-mail
addresses for the databases are:
!-GenBank: gb-sub@ncbi.nlm.nih.gov
!-EMBL: datasubs@ebi.ac.uk
!-DDBJ: ddbjsub@ddbj.nig.ac.jp
#After your entry is complete, close the record viewer. You will be
returned to the Welcome to Sequin form, and can begin another entry.
>The Record Viewer
*Target Sequence
#This pop-up menu shows a list of SeqIDs of all nucleotide and protein
sequences associated with the Sequin entry. Use the menu to select the
sequences displayed in the record viewer, as well as the sequences you
want to "target," that is, the sequences you want a descriptor to apply
to (see
Descriptors
in the Sequin help documentation). You may select
either an individual sequence by name or a set of sequences, such as All
Sequences, or SEG_dna if you have a segmented nucleotide set. You may
change the selection at any time.
*Display Format
#You may change the display format of the record viewer to any of the
formats described below.
Editing a field in one display format will change that field in all formats.
**Summary
#This display format shows the entry in a graphical summary format. It
is similar to the view shown in the Graphic viewer, except that lines
are not labeled. The top bar represents the nucleotide sequence. Lines
represent different features on the sequence, such as a CDS (coding
sequence) or additional sequences if you have a set of sequences.
Double click on an arrow or bar to
launch an editing window.
**Graphic
#This display format shows the entry in a graphical view. The top bar
represents the nucleotide sequence. Lower arrows or bars represent
different features on the sequence. Double click on an arrow or bar
to launch the appropriate editing window. Any sequence
highlighted in the Sequence Editor will be boxed on the graphical view of the
sequence. In order to see a graphical representation of a segmented set (see
Submission type
,
above), the Target Sequence must be set to
SEG_dna.
#The Style pop-up menu allows you to see the display in different styles
and colors.
#The Scale pop-up menu allows you to see the display in different sizes.
The smaller the number, the larger the display.
**Alignment
#This display format shows sets of aligned sequences, such as those
imported as part of a population, phylogenetic, mutation, or environmental samples set, when
the Target Sequence pop-up is set to All Sequences. Each sequence is
shown as a bar. Differences between the sequences are shown as red
vertical lines. To launch the viewer for an individual sequence, double
click on the bar representing the sequence. To lauch the alignment
editor, and see the alignment of all sequences, set the Target Sequence
to All Sequences, the Display Format to Alignment, highlight the
alignment by clicking on the box which surrounds the sequences, and
select Edit Alignment from the Sequin Edit menu.
**Sequence
#This display format shows the nucleotide sequence(s) in the record
along with any annotated features (such as CDS or mRNA). The display
changes depending on what options are selected. Use the Sequences
pop-up menu to choose the nucleotide sequences you want to display. If
there are multiple sequences in the record, select Aligned to see all
sequences. The entire sequence of the "master" sequence will be shown.
Other sequences will appear as dots where they are identical to the
master, and letters where they are different.
If the multiple sequences
were imported into Sequin as part of a phylogenetic, population, or
mutation study, the "master" sequence can be changed by selecting
different sequences in the Target Sequence pop-up. You can use the
Features pop-up menu to change the display of the features. You can
choose whether you want features displayed for the sequence selected in
the Target Sequence pop-up, for all aligned sequences, or for no
sequences. With the numbering pop-up menu, select where you want the
sequence numbers to be indicated, at the side of the window, at the top
of each sequence line, or not at all.
**GenBank
#This display format allows you to see the submission as it would appear
as a GenBank or DDBJ entry.
**EMBL
#This display format allows you to see the submission as it would appear
as an EMBL entry.
**FASTA
#This display shows the sequence and Definition line only, without any
annotations, in a format called the FASTA format. This is a format used
by many molecular biology analysis programs. You cannot edit in this
display mode.
**ASN.1
#This display shows the entry in Abstract Syntax Notation 1, a data
description language used by the NCBI. You cannot edit in this display
mode.
**Desktop
#The NCBI DeskTop displays the internal
structure of the record being viewed in Sequin. The
DeskTop
is explained under the Misc menu.
*Done
#This button allows you to validate the entry when you are finished with
the submission. See
Submitting the finished record to the database
in the Sequin help documentation.
*Controls on the bottom of the screen
#If you have downloaded a sequence from Entrez
you will see additional controls at the bottom of the
screen.
A sequence downloaded from Entrez will have Entrez neighboring/linking buttons.
For example, by selecting the Nucleotide pop-up, you will be able to view
nucleotide sequences which are similar to the sequence displayed in the Target
Sequence pop-up. Similarly, select Medline to view any literature links.
>Descriptors
*Overview
#Descriptors are annotations which apply to an entire sequence, or an
entire set of sequences, in a given entry. They do not have a specific
location on a sequence, as they apply to the entire sequence. They can
be contrasted to
Features,
which apply to a specific interval of the sequence.
#You may edit descriptors in one of two ways.
#(1) In the record viewer, double click within the text of the
descriptor to bring up a form on which information can be added.
#(2) Choose the option Descriptors from the Annotate menu.
*Annotate menu
#This menu allows you either to create new descriptors or to modify
existing ones. Select the descriptor that you wish to modify.
#When you first select a descriptor, you will see a window called
"Descriptor Target Control." Using the target control pop-up menu,
select the sequences you wish this descriptor to cover. The name(s)
listed correspond to the SeqID(s) given to the nucleotide or amino acid
sequences when when they were imported into Sequin. The default
selection for this menu is set in the Target Sequence pop-up menu on the
record viewer. You may choose to have the descriptor cover
just one sequence, or a set of sequences in your entry. If you are
creating a new descriptor, select "Create New." If you wish to modify a
previous descriptor, select "Edit Old."
#The following is a list of some of the descriptors which can be added.
Two additional descriptors, those for
Publications
and
Biological Source,
are described in other sections.
**Update date
#This is for database staff use only. Please do not modify the date.
**Create date
#This is for database staff use only. Please do not modify the date.
**GenBank block
#This is for database staff use only.
**Region
#This descriptor provides general information about the genetic context
of the sequence. For example, if your nucleotide sequence is cloned
from the region surrounding the Huntington's Disease gene, you could
enter that information here. Providing information for this descriptor
is optional.
**Comment
#This descriptor is used to list any additional information which you
wish to provide about the sequence. Use of this descriptor is optional.
**Title
#This descriptor contains the information which will go on the
Definition line of the database entry. If you supplied a title for your
nucleotide sequence when you imported it into Sequin, that information
is here. If you wish to change the Definition line, or if you did not
supply a title when you submitted the sequence, edit this Descriptor.
For more information on creating proper Definition lines, please see the
Sequin help documentation for the
Organism and Sequences Form.
**Molecule description
#This descriptor indicates the characteristics of the molecule from
which the sequence was derived. The information which you have already
entered can be edited here.
***Molecule
#A GenBank sequence can represent one of several different molecule
types. Enter in the Molecule pop-up menu the type of molecule that was
sequenced.
#-Genomic DNA: Sequence derived directly from the DNA of an organism.
Note: The DNA sequence of an rRNA gene has this molecule type.
#-Genomic RNA: Sequence derived directly from the genomic RNA of certain
organisms, such a viruses.
#-Precursor RNA: An RNA transcript before it is processed into mRNA,
rRNA, tRNA, or other cellular RNA species.
#-mRNA[cDNA]: A cDNA sequence derived from mRNA.
#-Ribosomal RNA: A sequence derived from the RNA in ribosomes, for
example, the sequence of a cDNA derived from rRNA.
#-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for
example, the sequence of a cDNA derived from tRNA.
#-Small nuclear RNA: A sequence derived from small nuclear RNA, for
example, the sequence of a cDNA derived from snRNA.
#-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA,
for example, the sequence of a cDNA derived from small cytoplasmic RNA.
#-Peptide: Do not select this item.
#-Other-Genetic [plasmid]: A sequence that is not normal genetic
material but that is also is not a transcription product. Examples
include plasmids, B chromosomes, and F factors.
#-Genomic mRNA: Do not select this item.
#-Other: Do not select this item.
***Completedness
Choose the appropriate option from the pop-up menu.
#-Complete: Use this designation when a complete unit, such as the
complete coding sequence of a gene, is being submitted.
#-Partial: Use this designation when an incomplete unit, such as the
partial coding sequence of a gene, is being submitted, and it is not
known which end of the sequence is incomplete.
#-No left: Use this designation when an incomplete unit, such as the
partial coding sequence of a gene, or a partial protein sequence, is
being submitted. The sequence has no left if it is incomplete on the
5', or amino-terminal, end.
#-No right: Use this designation when an incomplete unit, such as the
partial coding sequence of a gene, or a partial protein sequence, is
being submitted. The sequence has no right if it is incomplete on the
3', or carboxy-terminal, end.
#-No ends: Use this designation when an incomplete unit, such as the
partial coding sequence of a gene, or a partial protein sequence, is
being submitted, The sequence has no ends if it is incomplete at both
the 5' and 3', or amino- and carboxy- terminal, ends.
#-Other: Use this designation when none of the above descriptions apply.
***Technique
#From the pop-up menu, select the technique that was used to generate the
sequence.
#-Standard: standard sequencing technique.
#-EST: Expressed Sequence Tag: single-pass, low quality mRNA sequences
derived from cDNAs. These sequences will appear in the EST division.
#-STS: Sequence Tagged Site: an EST sequences which has been mapped
onto the genome. These sequences will appear in the STS division.
#-Survey: single pass genomic sequence. These sequences will appear in
the Genome Survey Sequence (GSS) division.
#-Genetic Map: genetic map information, for example, in the Genomes division.
#-Physical Map: physical map information, for example in the Genomes division.
#-Derived: A sequence assembled into a contig from shorter sequences.
#-Concept-trans: a protein translation generated with the appropriate genetic code.
#-Seq-pept: protein sequence was generated by direct sequencing of a
peptide.
#-Both: protein sequence was generated by conceptual translation and
confirmed by peptide sequencing.
#-Seq-pept-Overlap: protein sequence was generated by sequencing
multiple peptides, and the order of peptides was determined by overlap
in their sequences.
#-Seq-pept-Homol: protein sequence was generated by sequencing
multiple peptides, and the order of peptides was determined by homology
with another protein.
#-Concept-Trans-A: conceptual translation of the nucleotide sequence
provided by the author of the entry.
#-HTGS 0: High Throughput Genome Sequence, Phase 0. These sequences
are produced by high-throughput sequencing projects, and will be in the
HTG division.
#-HTGS 1: High Throughput Genome Sequence, Phase 1. These sequences
are produced by high-throughput sequencing projects, and will be in the
HTG division.
#-HTGS 2: High Throughput Genome Sequence, Phase 2. These sequences
are produced by high-throughput sequencing projects, and will be in the
HTG division.
#-HTGS 3: High Throughput Genome Sequence, Phase 3. These sequences
are produced by high-throughput sequencing projects, and will be in the
HTG division.
#-FLI_cDNA: Full Length Insert cDNA. Sequence corresponds to entire cDNA but not necessarily
entire transcript. These sequences are produced by large sequencing
projects.
#-HTC: High Throughput cDNA. These sequences are produced by large sequencing
projects.
#-Other: use this designation when none of the above descriptions apply.
***Class:
#From the pop-up menu, please select the type of molecule which was sequenced.
#-DNA: DNA
#-RNA: RNA
#-Protein: Protein
#-Nucleotide: Do not select this item.
#-Other: Do not select this item.
***Topology:
#From the pop-up menu, please select the topology of the sequenced molecule.
#-Linear: Linear molecule (most sequences)
#-Circular: Circular molecule (such as a complete plasmid)
#-Tandem: Do not select this item.
#-Other: Do not select this item.
***Strand:
#From the pop-up menu, please select which strand of the molecule was
sequenced.
#-Single: Only one strand was sequenced.
#-Double: Both strands were sequenced.
#-Mixed: In different regions, either one or both strands were sequenced.
#-Mixed Rev: Do not select this item.
#-Other: Do not select this item.
**Biological Source
#The Biological Source descriptor is described in more detail
below.
>Features
*Overview
#Features are annotations which apply to one or more intervals on a
sequence. They can be contrasted to
Descriptors,
which apply to an entire sequences or an entire set of sequences.
Features will be added to the Target Sequence selected in the record
viewer pop-up menu. Most features are indicated on the nucleotide
sequence even if they refer to amino acid sequence motifs.
#You may add or modify features in one of three ways.
#(1) In the record viewer, double click on the text of an existing feature to
bring up a form on which information can be added.
#(2) Choose the feature from the Annotate menu.
#(3) Choose the feature from the Sequence Editor Features menu.
#The features listed in the Annotate menu and the Sequence Editor Features menu
are identical, and the instructions for adding them are the same, with one
exception. If you annotate them in the Annotate menu, you must provide the
nucleotide sequence location of the feature. However, if you add features from
the Sequence Editor, you do not need to know their nucleotide coordinates.
Simply highlight the sequence which the feature covers, and the location of the
sequence will be automatically entered in the feature location box.
*Annotate menu
#This menu allows you to add or modify features on the sequence selected
in the Target Sequence pop-up menu of the record viewer. Features are
grouped into six categories. Select the feature which you would like
to mark on your sequence. A new form will appear.
#Feature forms share a common design. The first page is specific to the
particular feature, e.g., Coding Region or Gene. The second page lists
Properties of the Feature. The third page describes the Location of the
feature. Fill out the appropriate information on the first page.
**Properties Page
#This page lists the properties of the feature described by the
citation.
***General Subpage
#Enter general comments about the feature here.
#Select any of the flags if necessary. If this sequence contains only a
partial representation of the feature you are describing, check the
"Partial" box. Check the "Exception" box if the feature annotates a
post-transcriptional modification of the nucleotide sequence, such as
ribosomal slippage or RNA editing. Use the pop-up menu to select what
kind of evidence supports existence of the feature. If it was confirmed
experimentally, select Experimental. If you have no experimental
evidence to support the feature, select Non-Experimental. If you do not
wish to select either option, select the blank line.
#Most features are associated with a particular gene, normally the gene
from which the nucleotide sequence derives. Select the name of the gene
in the pop-up menu. If you want to add the name of a new gene, select
new, and enter its name and optional description. By default, mapping
between the feature and the gene is done by overlap, that is, the gene
associated with the feature is the gene whose location overlaps with the
location of the feature. Under some circumstances, for example, if the
sequences of two genes overlap, you may wish the feature to apply to a
different gene. In this case, select cross-reference, and enter the
name of the new gene in the pop-up menu. If you do not want the feature
to map to any gene, select suppress. You may also edit information on
the Gene feature form by clicking on Edit Gene Feature.
***Comment Subpage
#Add any comments about the feature here, especially if you checked the
"Exception" box on the General Subpage.
***Citations Subpage
#This page is used to list any citations which specifically apply to the
feature you are annotating. The citation must have already been entered
into the record (see
Publications
)
in the Sequin help documentation. Click on Edit Citations, and
place a check mark in box next to the publication you want to cite. In
order to keep the size of the database down, we discourage the liberal
use of citations on features.
***Cross-refs Subpage
#This page is used to cross-reference this entry to entries in external
databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as
dbEST or FLYBASE. Most users should leave this page blank. For more
information on this topic, see the International Nucleotide Sequence
Database Collaboration
page
.
http://www.ncbi.nlm.nih.gov/collab/db_xref.html
**Location page
#This page allows you to select the location of the feature you are
citing. Each feature must have an sequence interval associated with it.
In most cases, Sequin will know whether the feature applies to a nucleic
acid or a protein sequence, and will limit the options you can select,
accordingly.
#Sequin is a submission tool for nucleotide sequence databases. Thus,
the location for most features is indicated on the nucleotide sequence
only. For example, even though mature peptide, signal peptide, and
transit peptide describe protein sequence, their location is indicated
on the DNA.
#Check the 5' Partial or 3' Partial box if the feature in your nucleic
acid sequence is missing residues at the 5' or 3' ends, respectively.
Check the NH2 Partial or COO Partial if the feature in your amino acid
sequence is missing residues at the amino- or carboxy-terminal ends,
respectively.
#Enter the sequence range of the feature. The numbers should correspond
to the nucleotide sequence interval if the SeqID is set to a nucleotide
sequence, and to an amino acid sequence interval if the SeqID is set to
a protein sequence. If the feature spans multiple, non-continuous
intervals on the sequence, indicate the beginning and end points of each
interval. If each interval is separate, and should not be joined with
the others to describe the feature, check the Intersperse intervals with
gaps box (for example, when annotating multiple primer binding sites).
If the feature is composed of several intervals which should all be
joined together, do not check the box (for example, when annotating mRNA
on a genomic DNA sequence).
#For nucleic acid Features only: From the pop-up menu, select the
strand on which the feature is found.
#-Plus: Plus strand, or coding strand.
#-Minus: Minus strand, or noncoding strand.
#-Both: Both strands.
#-Reverse: Do not select this item.
#-Other: Do not select this item.
#Use the pop-up menu to select the SeqID of the sequence you are
describing by the location.
#A brief description of the available features follows. A detailed
explanation of how to use the coding region (CDS) feature is included.
The DDBJ/EMBL/GenBank feature table definition
page
http://www.ncbi.nlm.nih.gov/collab/FT/index.html
provides detailed information about other features.
*attenuator
#1) region of DNA at which regulation of termination of transcription
occurs, which controls the expression of some bacterial operons; 2)
sequence segment located between the promoter and the first structural
gene that causes partial termination of transcription
*C_region
#Constant region of immunoglobulin light and heavy chains, and T-cell
receptor alpha, beta, and gamma chains. Includes one or more exons
depending on the particular chain
*CAAT_signal
#CAAT box; part of a conserved sequence located about 75 bp upstream of
the start point of eukaryotic transcription units which may be involved
in RNA polymerase binding; consensus=GG(C or T)CAATCT
*CDS
#coding sequence; sequence of nucleotides that corresponds with the
sequence of amino acids in a protein (location includes stop codon).
Feature includes amino acid conceptual translation
**Coding Region Page
#Most users add a coding region to their sequence when they fill out the
Organism and Sequences form. However, you may need to edit the coding
region, or add additional ones. Choose CdRgn under the Coding Regions
and Transcripts submenu of the Features menu, or, to edit an existing
CDS, double click on the record viewer. If you appended the partial
sequence of a coding region to the Organism and Sequences form, you will
probably need to edit the Coding Region feature to avoid validation
error messages about the location of the coding region.
***General Subpage
#Choose the genetic code which should be used to translate the
nucleotide sequence. For more information, and for the translation
tables themselves, see the NCBI taxonomy
page
.
http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c
#Choose the reading frame in which to translate the sequence.
#Click on Launch Product Viewer to see the record viewer for the coding
region.
#Supply additional information about the protein by clicking on Edit
Protein Information to launch the Protein feature forms. The protein
name must have already been filled out on the Protein subpage.
#If retranslate on accept is checked, Sequin will, when you click on
Accept, translate the nucleotide sequence according to the interval(s)
indicated on the Locations page. This new translation will replace any
earlier translations you have supplied. This should not be a problem if
the interval was indicated appropriately. However, if you want to make
sure that Sequin does not retranslate the sequence, do not check the
box.
#If the coding sequence which you supply is a partial sequence, and you
have checked a Partial box on the Location subpage, it is a good idea to
check the Synchronize Partials box. In this case, Sequin will ensure
that all other appropriate features (such as protein) are also marked as
partial.
***Exceptions Subpage
#Exceptions describe places where there is a posttranslational
modification. Enter the amino acid position at which the modification
occurs, and select the amino acid which is actually represented in the
protein from the pop-up list. Sequin will change the amino acid number
to a nucleotide interval.
***Protein Subpage
#Use this page to enter or edit a name or description of the protein
product. For a new sequence, enter information directly into the boxes.
You can edit descriptions of an existing sequence by clicking on Edit
Protein Information, which will bring up the Protein feature form.
***Product Subpage
#Choose the sequence you wish to view by selecting its name under the
Product pop-up menu. You may also import a new protein sequence by
selecting Import Protein FASTA under the file menu. The sequence should
be formatted as described above on the Organism and Sequences form.
#After you have imported a protein sequence, click on Predict Interval.
This function will predict the interval on the nucleotide sequence to
which the coding region applies. If you do not select this function, the
interval will likely be wrong, and you will get error message when you
attempt to validate the record. If your sequence is a 5' or 3' partial,
you must first indicate this manually on the Locations Page.
#You may also have Sequin generate the protein sequence from the
nucleotide sequence by clicking on Translate Product. However, unless
the location of the coding region is correctly indicated on the Location
page, Sequin will translate the entire nucleotide sequence, including
potential 5' and 3' untranslated regions. This will likely result in
error messages when you attempt to validate the record. You must also
select the correct reading frame on the General subpage.
*conflict
#independent determinations of the "same" sequence differ at this site
or region
*D-loop
#displacement loop; a region within mitochondrial DNA in which a short
stretch of RNA is paired with one strand of DNA, displacing the original
partner DNA strand in this region; also used to describe the
displacement of a region of one strand of duplex DNA by a single
stranded invader in the reaction catalyzed by RecA protein
*D_segment
#Diversity segment of immunoglobulin heavy chain, and T-cell receptor
beta chain
*enhancer
#a cis-acting sequence that increases the utilization of (some)
eukaryotic promoters, and can function in either orientation and in any
location (upstream or downstream) relative to the promoter
*exon
#region of genome that codes for portion of spliced mRNA; may contain
5'UTR, all CDSs, and 3' UTR
*GC_signal
#GC box; a conserved GC-rich region located upstream of the start point
of eukaryotic transcription units which may occur in multiple copies or
in either orientation; consensus=GGGCGG
*gene
#region of biological interest identified as a gene and for which a name
has been assigned
*iDNA
#intervening DNA; DNA which is eliminated through any of several kinds
of recombination
*intron
#a segment of DNA that is transcribed, but removed from within the
transcript by splicing together the sequences (exons) on either side of
it
*J_segment
#Joining segment of immunoglobulin light and heavy chains, and T-cell
receptor alpha, beta, and gamma chains
*LTR
#long terminal repeat, a sequence directly repeated at both ends of a
defined sequence, of the sort typically found in retroviruses
*mat_peptide
#mature peptide or protein coding sequence; coding sequence for the
mature or final peptide or protein product following post-translational
modification. the location does not include the stop codon (unlike the
corresponding CDS)
*misc_binding
#site in nucleic acid which covalently or non-covalently binds another
moiety that cannot be described by any other Binding key (primer_bind or
protein_bind)
*misc_difference
#feature sequence is different from that presented in the entry and
cannot be described by any other Difference key (conflict, unsure,
old_sequence, mutation, variation, allele, or modified_base)
*misc_feature
#region of biological interest which cannot be described by any other
feature key
*misc_recomb
#site of any generalized, site-specific or replicative recombination
event where there is a breakage and reunion of duplex DNA that cannot be
described by other recombination keys (iDNA and virion) or qualifiers of
source key (/insertion_seq, /transposon, /proviral)
*misc_RNA
#any transcript or RNA product that cannot be defined by other RNA keys
(prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR,
exon, intron, polyA_site, rRNA, tRNA, scRNA, and snRNA)
*misc_signal
#any region containing a signal controlling or altering gene function or
expression that cannot be described by other Signal keys (promoter,
CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS,
polyA_signal, enhancer, attenuator, terminator, and rep_origin)
*misc_structure
#any secondary or tertiary structure or conformation that cannot be
described by other Structure keys (stem_loop and D-loop)
*modified_base
#the indicated nucleotide is a modified nucleotide and should be
substituted for by the indicated molecule (given in the mod_base
qualifier value)
*mRNA
#messenger RNA; includes 5'untranslated region (5'UTR), coding sequences
(CDS, exon) and 3'untranslated region (3'UTR)
*N_region
#Extra nucleotides inserted between rearranged immunoglobulin segments
*old_sequence
#the presented sequence revises a previous version of the sequence at
this location
*polyA_signal
#recognition region necessary for endonuclease cleavage of an RNA
transcript that is followed by polyadenylation; consensus=AATAAA
*polyA_site
#site on an RNA transcript to which will be added adenine residues by
post-transcriptional polyadenylation
*precursor_RNA
#any RNA species that is not yet the mature RNA product; may include 5'
clipped region (5'clip), 5' untranslated region (5'UTR), coding
sequences (CDS, exon), intervening sequences (intron), 3' untranslated
region (3'UTR), and 3' clipped region (3'clip)
*prim_transcript
#primary (initial, unprocessed) transcript; includes 5' clipped region
(5'clip), 5' untranslated region (5'UTR), coding sequences (CDS, exon),
intervening sequences (intron), 3' untranslated region (3'UTR), and 3'
clipped region (3'clip)
*primer_bind
#Non-covalent primer binding site for initiation of replication,
transcription, or reverse transcription. Includes site(s) for synthetic
e.g., PCR primer elements
*promoter
#region on a DNA molecule involved in RNA polymerase binding to initiate
transcription
*protein_bind
#non-covalent protein binding site on nucleic acid
*RBS
#ribosome binding site
*repeat_region
#region of genome containing repeating units
*repeat_unit
#single repeat element
*rep_origin
#origin of replication; starting site for duplication of nucleic acid to
give two identical copies
*rRNA
#mature ribosomal RNA ; the RNA component of the ribonucleoprotein
particle (ribosome) which assembles amino acids into proteins
*S_region
#Switch region of immunoglobulin heavy chains. Involved in the
rearrangement of heavy chain DNA leading to the expression of a
different immunoglobulin class from the same B-cell
*satellite
#many tandem repeats (identical or related) of a short basic repeating
unit; many have a base composition or other property different from the
genome average that allows them to be separated from the bulk (main
band) genomic DNA
*scRNA
#small cytoplasmic RNA; any one of several small cytoplasmic RNA
molecules present in the cytoplasm and (sometimes) nucleus of a
eukaryote
*sig_peptide
#signal peptide coding sequence; coding sequence for an N-terminal
domain of a secreted protein; this domain is involved in attaching
nascent polypeptide to the membrane; leader sequence
*snRNA
#small nuclear RNA; any one of many small RNA species confined to the
nucleus; several of the snRNAs are involved in splicing or other RNA
processing reactions
*source
#identifies the biological source of the specified span of the sequence.
This key is mandatory. Every entry will have, as a minimum, a single
source key spanning the entire sequence. More than one source key per
sequence is permittable
*stem_loop
#hairpin; a double-helical region formed by base-pairing between
adjacent (inverted) complementary sequences in a single strand of RNA or
DNA
*STS
#Sequence Tagged Site. Short, single-copy DNA sequence that
characterizes a mapping landmark on the genome and can be detected by
PCR. A region of the genome can be mapped by determining the order of a
series of STSs
*TATA_signal
#TATA box; Goldberg-Hogness box; a conserved AT-rich septamer found
about 25 bp before the start point of each eukaryotic RNA polymerase II
transcript unit which may be involved in positioning the enzyme for
correct initiation; consensus=TATA(A or T)A(A or T)
*terminator
#sequence of DNA located either at the end of the transcript or adjacent
to a promoter region that causes RNA polymerase to terminate
transcription; may also be site of binding of repressor protein
*transit_peptide
#transit peptide coding sequence; coding sequence for an N-terminal
domain of a nuclear-encoded organellar protein; this domain is involved
in post- translational import of the protein into the organelle
*tRNA
#mature transfer RNA, a small RNA molecule (75-85 bases long) that
mediates the translation of a nucleic acid sequence into an amino acid
sequence
*unsure
#author is unsure of exact sequence in this region
*V_region
#Variable region of immunoglobulin light and heavy chains, and T-cell
receptor alpha, beta, and gamma chains. Codes for the variable amino
terminal portion. Can be made up from V_segments, D_segments,
N_regions, and J_segments
*V_segment
#Variable segment of immunoglobulin light and heavy chains, and T-cell
receptor alpha, beta, and gamma chains. Codes for most of the variable
region (V_region) and the last few amino acids of the leader peptide
*variation
#a related strain contains stable mutations from the same gene (e.g.,
RFLPs, polymorphisms, etc.) which differ from the presented sequence at
this location (and possibly others)
*3'clip
#3'-most region of a precursor transcript that is clipped off during
processing
*3'UTR
#region near or at the 3' end of a mature transcript (usually following
the stop codon) that is not translated into a protein; trailer
*5'clip
#5'-most region of a precursor transcript that is clipped off during
processing
*5'UTR
#region near or at the 5' end of a mature transcript (usually preceding
the initiation codon) that is not translated into a protein; leader
* -10_signal
#Pribnow box; a conserved region about 10 bp upstream of the start point
of bacterial transcription units which may be involved in binding RNA
polymerase; consensus=TAtAaT
* -35_signal
#a conserved hexamer about 35 bp upstream of the start point of
bacterial transcription units; consensus = TTGACa or TGTTGACA
>Biological Source
#This annotation is very important, as an entry cannot be processed by
the databases unless it includes some basic information about the
organism from which the sequence derived. This basic information was
entered previously in the submission, in the Organism and Sequences
Form. The more detailed Organism Information form allows you to alter
or add to the data you entered earlier.
*Overview: Descriptor or Feature?
#Sequin allows two types of biological source information to be entered,
Biological Source Descriptors and Biological Source Features. Biological
Source Descriptors, like other descriptors, provide organism information
about an entire sequence, or an entire set of sequences, in an entry.
Biological Source Features, like other features, provide organism
information about a specific interval on a given sequence.
#In most cases, you will want to use a Biological Source Descriptor, as
all the sequences in the entry will derive from the same source.
However, if you have sequenced a chimeric molecule, for example, one
that is part yeast and part mouse, you would use Biological Source
Features to annotate which sequence derived from yeast and which from
mouse.
#To add a Biological Source Descriptor, select Biological Source under
the Descriptor section of the Annotate menu. To add a Biological
Source Feature, select Biological Source under the Bibliographic and
Comments section of the Annotate menu.
#Annotating a Biological Source Descriptor or Feature is similar to
annotating any descriptor or feature. For help in creating descriptors
and features, see the appropriate section of the help documentation.
The following are instructions for filling out Biological
Source-specific forms.
*Organism Page.
**Names Subpage
#The scrollable list contains the scientific names of many organisms.
To reach a name on the list, either type the first few letters of the
scientific name, or use the thumb bar. Click on a name from the list to
fill out the scientific name field. If there is a common name for the
organism, that field will be filled out automatically. You may also
directly type in the scientific name. If you have any questions about
the scientific or common name of an organism, see the NCBI
taxonomy browser
http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
**Location Subpage
***Location of Sequence
#From the selection list, please enter the location of the genome which
contains your sequence. Most entries will have a "Genomic" location.
A brief description of the choices in this pop-up menu were listed
previously.
***Origin of Sequence
#This menu is for the use of database personnel. Please leave this
field empty.
**Genetic Codes Subpage
***Nuclear
#Please use this field to select the genetic code which should be used
to translate the nucleic acid sequence. The genetic code for a
eukaryotic organism is "Standard". If you selected an organism name
from the scrollable list described above, this field was filled out
automatically.
#For more information regarding the translation tables available, see the NCBI
taxonomy
page
.
http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c
***Mitochondrial
#-Do not select this item.
**Lineage Subpage
#This information is normally entered by the database staff. They will
use the
taxonomy database
http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
maintained by the NCBI/GenBank.
If you wish to enter a
taxonomic lineage which is different than that in the NCBI database,
please enter it here.
#If you are running Sequin in its
network-aware
mode, you will see a button labelled "Lookup Taxonomy." Click on this
button to perform an automatic lookup of the taxonomic lineage of the
organism. Sequin will perform the lookup by accessing the Taxonomy
database at the NCBI, and will fill out the Taxonomic Lineage and
Division fields.
#If you have any comments about the taxonomic lineage determined by
Sequin, please submit these comments with your entry. Under the Sequin
File menu, select Edit Submitter Info. Enter your comments in the box
entitled "Special Instructions to Database Staff", on the Submission
page. Someone from the NCBI will contact you after your submission is
received.
*Modifiers Page
#This page allows you to enter additional information about the source
and/or organism. Entering information is optional.
**Source Subpage
#Choose a modifier from the pull-down menu on the left side of the page
and type the appropriate name on the right side of the page. If you do
not find appropriate modifiers in the scroll down list, you can enter
additional source information as text in the field at the bottom of the
page. You may select as many modifiers as you want.
#The following is a description of the available modifiers:
#-Chromosome: Chromosome to which the gene maps.
#-Map: Map location of the gene.
#-Clone: Name of clone from which sequence was obtained.
#-Subclone: Name of subclone from which sequence was obtained.
#-Haplotype: Haplotype of the organism.
#-Genotype: Genotype of the organism.
#-Sex: Sex of the organism from which the sequence derives.
#-Cell-line: Cell line from which sequence derives.
#-Cell-type: Type of cell from which sequence derives.
#-Tissue-type: Type of tissue from which sequence derives.
#-Clone-lib: Name of library from which sequence was obtained.
#-Dev-stage: Developmental stage of organism.
#-Frequency: Frequency of occurrence of a feature.
#-Germline: If the sequence shown is DNA and a member of the
immunoglobulin family, this qualifier is used to denote that the
sequence is from unrearranged DNA.
#-Rearranged: If the sequence shown is DNA and a member of the
immunoglobulin family, this qualifier is used to denote that the
sequence is from rearranged DNA.
#-Lab-host: Laboratory host used to propagate the organism from which
the sequence was derived.
#-Pop-variant: Name of the population variant from which the sequence was
obtained.
#-Tissue-lib: Tissue library from which the sequence was obtained.
#-Plasmid-name: Name of plasmid from which the sequence was obtained.
#-Transposon-name: Name of transposable element from which the sequence was
obtained.
#-Ins-sequence-name: Name of insertion element from which the sequence was
obtained.
#-Plastid-name: Name of plastid from which the sequence was obtained.
#-Country: The country of origin of DNA samples used for epidemiological or
population studies.
#-Segment: Name of viral genome fragmented into two or more nucleic acid molecules.
#-Endogenous-virus-name: Name of inactive virus that is integrated into the
chromosome of its host cell and can therefore exhibit vertical transmission.
**Organism Subpage
#Choose a modifier from the pull-down menu on the left side of the page
and type the appropriate name on the right side of the page. If you do
not find appropriate modifiers in the scroll down list, you can enter
additional organism information as text in the field at the bottom of
the page. You may select as many modifiers as you want.
#The following is a description of the available modifiers:
#-Strain: Strain of organism from which sequence was obtained.
#-Substrain: Sub-strain of organism from which sequence was obtained.
#-Type: Type of organism from which sequence was obtained.
#-Subtype: Subtype of organism from which sequence was obtained.
#-Variety: Variety of organism from which sequence was obtained.
#-Serotype: Variety of a species (usually a fungus, bacteria or virus)
characterized by its antigenic properties. Same as serogroup and
serovar.
#-Serogroup: See serotype.
#-Serovar: See serotype.
#-Cultivar: Cultivated variety of plant from which sequence was obtained.
#-Pathovar: Variety of a species (usually a fungus, bacteria or virus)
characterized by the biological target of the pathogen. Examples
include Pseudomonas syringae pathovar tomato and Pseudomonas syringae
pathovar tabaci.
#-Chemovar: Variety of a species (usually a fungus, bacteria or virus)
characterized by its biochemical properties.
#-Biovar: Variety of a species (usually a fungus, bacteria or virus)
characterized by some specific biological property (often geographical,
ecological, or physiological). Same as biotype.
#-Biotype: See biovar.
#-Group: Do not select this item.
#-Subgroup: Do not select this item.
#-Isolate: Identification or description of the specific individual
from which this sequence was obtained. An example is Patient X14.
#-Common: Common name of the organism from which sequence was obtained.
#-Acronym: Standard synonym (usually of a virus) based on the initials
of the formal name. An example is HIV-1.
#-Dosage: Do not select this item.
#-Natural Host: When the sequence submission is from an organism that
exists in a symbiotic, parasitic or other special relationship with some
second organism, the 'natural host' modifier can be used to identify the
name of the host species.
#-Sub-species: Subspecies of organism from which sequence was obtained.
#-Specimen-voucher: An identifier of the individual or collection of the source
organism and the place where it is currently stored, usually an institution.
#-Authority: The author or authors of the organism name from which sequence
was obtained.
#-Forma: The forma (lowest taxonomic unit governed by the nomenclatural
codes) of organism from which sequence was obtained. This term is usually
applied to plants and fungi.
#-Forma-specialis: The physiologically distinct form from which sequence
was obtained (usually restricted to certain parasitic fungi).
#-Ecotype: The named ecotype (population adapted to a local habitat) from
which sequence was obtained (customarily applied to populations of
Arabidopsis thaliana).
#-Synonym: The synonym (alternate scientific name) of the organism name
from which sequence was obtained.
#-Anamorph: The scientific name applied to the asexual phase of a fungus.
#-Teleomorph: The scientific name applied to the sexual phase of a fungus.
#-Breed: The named breed from which sequence was obtained (usually applied
to domesticated mammals).
#-Old name: Do not select this item.
*Miscellaneous Page
**Synonyms Subpage
#If there are alternative names for the organism from which the sequence
derives, enter them here. Please be aware that this is the appropriate
field only for alternative names for the organism, not for alternative
gene or protein names.
**Cross-refs Subpage
#This page is used to cross-reference this entry to entries in external
databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as
dbEST or FLYBASE. Most users should leave this page blank. For more
information on this topic, see the International Nucleotide Sequence
Database Collaboration
page
.
http://www.ncbi.nlm.nih.gov/collab/db_xref.html
>Publications
*Overview: Descriptor or Feature?
#Sequin allows two types of publications to be entered, Publication
Descriptors and Publication Features. Publication Descriptors are
bibliographic references which, like other descriptors, cover an entire
sequence, or an entire set of sequences, in an entry. Publication
Features are bibliographic references which, like other features, cover
a specific interval on a given sequence.
#Publications are entered into the Reference field of the database
entry. References are citations of unpublished, in press, or published
works which are relevant to the submitted sequence. You may add as many
citations as you wish. However, you must decide whether the Publication
should be entered as a descriptor or a feature.
#In general, if there is one publication describing a sequence, a
Publication Descriptor should be used. If multiple publications all
describe the same sequence, only the reference which appeared first in
print should be included in the descriptor. To enter a Publication
Decriptor, select Publications under the Annotate menu, and click on
Publication Descriptor.
#However, if one publication describes the cloning of the 5' end of a
gene, and another publication describes the cloning of the 3' end of the
gene, Publication features should be used. To make a publication
feature, first, enter the publication itself into the record by choosing
Publication Feature in the Publications section of the Annotate menu.
Enter the information about the publication, and then enter the interval
(on the Location page) that the publication refers to. Next, add this
reference to the feature by double clicking on the feature, going to the
Citations subpage of the Properties page, clicking on Edit Citations,
and selecting the citation(s) you want to add.
#We do not encourage the liberal use of Publication Features in an entry
in an effort to keep the size of the database down. Please enter a
reference for a feature only if it is a novel or controversial feature.
#If you plan to add a reference to a published journal article, you
should run Sequin in its network-aware mode. In this mode, the program,
if supplied with certain minimal information, automatically fills out
the Title, Authors, and Journal pages by looking up the information in
the Medline database.
Instructions
for making Sequin network aware are provided in the documentation for
the Misc menu.
Instructions
for performing a Medline lookup are provided below.
#Annotating a Publication Descriptor or a Publication Feature is similar
to annotating any descriptor or feature. For help in creating
descriptors and features, see the appropriate section of the help
documentation. The following are instructions for filling out
Publication-specific forms.
*Citation on Entry Form
**Status
#Using the radio buttons, select one of the three options:
#-Unpublished: Select this option if (1) There are no plans to publish a
manuscript describing this sequence submission, (2) A manuscript has
been written
but not yet submitted, or, (3) A manuscript has been submitted for
publication but has not yet been accepted.
#-In Press: The article has been accepted for publication but is not yet in
print.
#-Published: The article has been published.
**Class
#Using the radio buttons, select the type of publication in which the
sequence will appear.
#-Journal: Journal
#-Book Chapter: Chapter in a book
#-Book: Entire book
#-Thesis/Monograph: Thesis or monograph
#-Proceedings Chapter: Abstract from a meeting
#-Proceedings: A meeting
#-Patent: Patent
#-Submission:
**Scope
Please select one or more option using the radio buttons:
#-Refers to the entire sequence: The publication listed in this
citation describes the entire sequence in this entry. This is most
commonly the publication in which the sequence is first described.
#-Refers to part of the sequence: The publication listed in this
citation describes only a part of the sequence. This option should be
used when (1) Different parts of a sequence have been generated by
different investigators, or (2) The sequence was generated in segments
over a period of time.
#-Cites a feature on the sequence: The publication listed in this
citation describes or refers to a feature (such as a class of promoter
or a motif) which has been found in the sequence.
#After you have filled out the Citation on Entry form, click on
"Proceed" to see the next form.
*Citation Information Form (General)
#At the bottom of each page are two options: Accept and Cancel. Click
on "Accept" to replace all parts of an existing citation with the
information entered on this form. Click "Cancel" to cancel the process
of changing a citation.
**Authors Page
***Names Subpage
#Please enter the names of the authors. Note that the first name of the
author is listed first. You can add as many authors to this page as you
wish. After you type in the name of the third author, the box becomes a
spreadsheet, and you can scroll down to the next line by using the thumb
bar.
***Affiliation Subpage
#Please enter information about the institution with which the principal
author of the manuscript is affiliated.
#Other pages in the Citation Information Form will be different
depending on the Class of publication selected in the Citation on Entry
Form. Instructions for filling out the Citation Information Form for
Journals is included here.
*Citation Information Form (If selected Class was Journal)
**Title Page
#Enter title for manuscript in the box.
**Journal Page
#Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year
fields by typing information into the boxes. Select the month with the
pop-up menu. If necessary, choose an option from the Erratum pop-up menu
and explain the erratum. If you know the MUID, the Medline Unique
Identifier, please enter it.
#If you are running Sequin in its
network-aware
mode, the program will look up the Title, Author, and Journal
information in the Medline database if you supply it with some minimal
information. For example, if you know the MUID (Medline Unique
Identifier) of the publication, enter it in the appropriate box and
select "Lookup By MUID." Sequin will automatically retrieve the rest of
the information. One way to find the MUID of the publication is to look
up the publication with the NCBI's
Entrez
service. Alternatively, if you do not know the MUID, enter the Journal,
Volume, Pages, and Year. Then select "Lookup Article." Sequin will
retrieve the missing Title and Authors inforamtion.
**Remark Page
#This can be any additional comment that should be associated with this
citation.
>File Menu
*About Sequin
#Details about the current version of Sequin.
*Help
#Launches the help documentation.
*Open
#Open an existing entry. This option will open a record which has been
previously saved in Sequin. Furthermore, for analysis purposes, it can also
open
a FASTA-formatted sequence file. The sequence will be displayed in Sequin and
can be analyzed with tools such as CDD BLAST, but it should not be submitted,
because it does not have the appropriate annotations.
*FASTA Nucleotide Direct to Sequence Editor
#Opens a FASTA formatted sequence directly into the Sequence Editor. The
sequence can then be analyzed with tools such as the
"Find"
command.
*Close
#Close this entry.
*Export GenBank
#Exports the GenBank flatfile format to a file.
*Duplicate View
#Duplicates the entry. You can then view the entry simultaneously in
different Display Formats.
*Save
#Saves the entry. Note: This merely saves the entry so you can go back
and edit it. It does not prepare the entry for submission to the
database, that is, it does not validate the entry.
*Save As
#See Save.
*Restore
#Replaces the displayed record with previously saved version. This
feature is useful if you have made unwanted changes since you last saved
the record.
*Prepare Submission
#Prepares the entry for submission to the database. See
Submitting the finished record to the database
in the Sequin help documentation.
*Print
#Prints the window which is currently selected. The selected window can
be one of the Sequin forms or pages, or the help documentation.
*Quit
#Exit from Sequin.
>Edit Menu
*Copy
#Copy the selected item.
*Clear
#Clear the selected item.
*Duplicate
#Duplicates the selected feature.
*Edit sequence
#To edit a single sequence, select the sequence identifier in the Target
Sequence pop-up menu, and click on Edit sequence. The sequence editor
will be launched for that sequence. The
sequence editor
is discussed in more detail below.
*Edit alignment
#To edit a set of aligned sequences, select All Sequences in the Target
Sequence pop-up menu and select Alignment in the Display Format.
Highlight the alignment by clicking inside of the box surrounding the
sequence bars, and click on Edit alignment. The alignment editor will
be launched. The
alignment
editor is discussed in more detail below.
*Edit Submitter Info
#Opens up the Submission Instructions form, which allows you to enter
additional information about the person submitting the record. Much of
this information was entered on the first form in Sequin, the Submitting
Authors form.
#You can also save the information from the Submitting Authors form here, so
that
you can use it in subsequent Sequin submissions. Click on "Edit Submitter
Info",
and, under the file menu in the resulting Submission Instructions form, click
on
Export Submitter Info to save the information to a file. For subsequent Sequin
submissions, if you have already saved the submittor information, click on
Import
Submitter Info under the File menu on the Submission page of the Submitting
Authors form.
**Submission page
#Indicate the type of submission. If it is a new submission, select
New. If you are updating an existing submission in order to resubmit it
to the databases, select Update. Check either the "Yes" or "No" radio
button to indicate if the record should be released before publication.
If you select "Yes," the entry will be released to the public after the
database staff has added it to the database. If you select "No," fields
will appear in which you can indicate the date on which the sequences
should be released to the public. The submission will then be held back
by the database staff until formal publication of the sequence or
GenBank Accession Number, or until the Release Date, whichever comes
first. If you have any special instructions, enter them in the box at
the bottom of the page.
**Contact page
#Update the name, affiliation, or contact numbers of the person
submitting the record.
**Citation page
#Update the names and affiliation of the people who should receive
scientific credit for the generation of sequences in this entry. The
address should list the principal institution in which the sequencing
and/or analysis was carried out. If multiple labs were involved in the
project, this page should contain information about the workplace of the
senior author. If you are submitting the record as an update to the
databases, explain the reason for the update on the Description subpage.
*Update Sequence
#This selection allows you to replace a sequence with another sequence, merge
two sequences which overlap at their ends, 'patch' a corrected fragment of a
sequence to the current sequence, or copy features from one sequence to another.
#Use Read FASTA file to import a sequence in FASTA format. Use Read Sequence
Record to import a sequence in ASN.1 format (for example, a sequence record
which has already been saved in Sequin). If you are running Sequin in
Network Aware mode,
you can use Download Accession to import a record from Entrez. If
you have done a QBLAST search, you can use Selected Alignment to import a
sequence from the alignment that you have selected in the Graphic or Alignment
view.
#In all cases, the imported and original sequences must have regions similar
enough for the two sequences to be aligned. If the sequences are not
similar enough to generate an alignment, Sequin will inform you that
the similarity is insufficient to perform the update.
#After you import the updated sequence, a new window will open which displays
two graphical views and the text of the alignment of the new and old sequence.
The first graphic displays the relative length of the two sequences and the
length of the overlapping region between sequences. The second graphic
represents any inserts, deletions, or point changes within the aligned region
between the new and old sequences. Clicking on a region in this graphic will
scroll to the corresponding nucleotide sequence in the alignment text below.
#The alignment relationship box shows the action that will be performed upon
updating the sequence: i.e., replace, extend 5', extend 3', or patch. The patch
function allows you to replace an internal fragment of the sequence without
affecting flanking regions.
#When updating via the Download Accession or Read Sequence Record methods, the
update operation box allows you to specify whether the sequence and/or the
features should be updated. In cases where the new and old records contain
duplicate features, you may chose to retain the new and/or old feature or
merge the duplicated features into one.
*Feature Propagate
#This selection allows you to propagate any annotated feature from
one sequence in an aligned set to other sequences within the set. For
example, if one nucleotide sequence in the alignment contains a CDS feature,
you can annotate a similar CDS, over the same interval, to the other
nucleotide sequences in the set.
#The default source of features to be propagated is the first member
of the set. If you wish to use a different entry as the source of
the features, scope to that entry in the Target Sequence menu before
selecting Feature Propagate from the Edit menu.
#The Feature Propagate window allows you to select which features will
be propagated and whether the features will be extended or split at
gaps in the alignment. The split at gaps selection will produce two
features, one on either side of the gap within the alignment. If you
are propagating a CDS feature, you may specify that the translation end
or extend through internal stop codons. You may also extend the
translation after the stop codon on the source entry by chosing to
translate the CDS after partial 3' boundary.
*Add Sequence
#This selection allows you to add a new sequence to an existing
population, mutation, phylogenetic, or environmental sample set.
You may import the new entry in FASTA format or ASN.1 format (for
example, a sequence record which has been saved in Sequin).
>Search menu
*Find ASN.1
#Under this command, you can find and replace strings of letters in
those fields of your submission that contain manually entered data. The
fields which can be altered are Locus, Definition, Accession, Keywords,
Source, Reference and Features. To use this option, select Find and fill
the Find and Replace lines with the appropriate text. Note that you
cannot edit the sequence in this way.
*Find FlatFile
#Under this command, you can find strings of letters in
all fields of your submission.
*Validate
#This option detects discrepancies between the format of your submission
and that required by the database selected for entry. If discrepancies
are present, it suggests ways in which to correct them. See the topic on
Submitting the finished record to the database
in the Sequin help documentation.
*Spell Check
#Performs a spelling check on the record.
*CDD BLAST
#Performs a CDD BLAST search of the selected sequence against the
NCBI's
Conserved Domain Database
. In order to do a CDD BLAST search, Sequin must be in its network aware mode.
#CDD currently contains domains derived from two popular collections, Smart
and Pfam, plus contributions from colleagues at NCBI. The source
databases also provide descriptions and links to citations. Since
conserved domains correspond to compact structural units, CDs contain links
to 3D-structure via Cn3D whenever possible
#The results of the CDD search will be displayed in the record
viewer. These results are for your use only and should be removed
from the record before submission.
*ORF Finder
#The ORF Finder shows a graphical representation of all the open reading
frames (ORFs) in the nucleotide sequence. This tool allows you to
select ORFs and have them appear as coding sequence (CDS) features on
the sequence record.
#The ORFs, indicated by colored boxes, are defined as the longest
sequence which stretches from a start codon to a stop codon. If the
entire nucleotide sequence is an open reading frame, but does not
contain an initial start or a terminal stop codon, it will be indicated
as an ORF as well. All six reading frames are shown; the top three
boxes represent the plus strands, and the bottom three boxes the minus
strands. The nucleotide sequence intervals of the ORFs are displayed in
descending length order on the right side of the window. Intervals on
the complementary (minus) strand are indicated by a c. ORFs can be
selected by clicking either directly on them or on the sequence
interval. The ORF length button selects the length of ORFs which are
displayed. For example, the default of 10 shows all ORFs which are
greater than 10 nucleotides in length. Clicking on the box labelled ORF
changes the display; potential start codons are indicated in white, and
stop codons in red. ORFs can be selected in this display also. The
definition of start and stop codons is dependent on the genetic code
which was selected. Be sure to choose the appropriate genetic code from
translating the sequence before opening the ORF finder.
#The ORF finder works in conjunction with the Sequence Editor. Once an
ORF is selected, its sequence is highlighted in the editor. Using tools
in the Sequence Editor, you can make the highlighted sequence into a
CDS, translate it, and save it as a CDS feature in the record. See the
documentation on
Editing a CDS
in the
Sequence editor
.
*Select Target
#This option changes the sequence which is selected in the Target Sequence
pop-up. Type the SeqID of the sequence in the box, and the record viewer will
be
updated to display that sequence.
>Misc Menu
*Style Manager
#The Style manager allows you to choose between different formats in
which to view the Graphical Display Format. The graphical display is
selected by choosing the Graphic display format on the record viewer.
Using the Style Manager, you can also copy the style or modify it to
suit your needs.
*Net Configure
#As a default, Sequin is available as a stand-alone program. However,
the program can also be configured to exchange information with the NCBI
(GenBank) over the Internet. The network-aware mode of Sequin is
identical to the stand-alone mode, but it contains some additional
useful options.
#Sequin will only function in its network-aware mode if the computer on
which it resides has a direct Internet connection. Electronic mail
access to the Internet is insufficient. In general, if you can install
and use a WWW-browser on your system, you should be able to install and
use network-aware Sequin. Check with your system administrator or
Internet provider if you are uncertain as to whether you have direct
Internet connectivity.
#There are two ways to change Sequin into its network aware mode. If
you are still on the initial Welcome to Sequin form, select Net
Configure under the Misc menu. If you have already worked on a Sequin
submission, and are looking at the record in the record viewer, select
the Net Configure option from the Misc menu.
#Most users will be able to use the default (Normal) settings on the Network
Configuration page; select Accept to complete the configuration process.
#If a "Normal" Connection does not work, you may need to select the Firewall
Connection. Contact your system administrator to determine what to enter into
the Proxy and Port fields. If you do not have access to domain name server
(DNS), uncheck this box.
#The Timeout pop-up selects the length of time which your local copy of Sequin
will wait for a reply from the NCBI server. You may need to set this number
higher (i.e., 60 seconds or 5 minutes) if you are outside of the United States
or have a bad internet connection.
#If you have problems setting up the network configuration, contact
info@ncbi.nlm.nih.gov
#If you wish to change Sequin back to its stand-alone mode, select Net
Configure again from the Misc menu. Click on Connection: None.
#The network-aware mode of Sequin allows you to perform a number of
additional, important functions. These functions all appear as
additional menu items. A brief description of these functions follows.
Further descriptions are available as indicated elsewhere in the help
documentation.
**Updating existing GenBank records:
#Using Sequin in its network-aware mode, you can download an existing
GenBank record from Entrez using the GenBank accession number or GI
identification number (NID). You can then use Sequin to make any
necessary changes to the record, and resubmit it to GenBank as a
sequence update.
Instructions
for submitting sequence updates are presented under the Welcome to
Sequin Form. You can download any record from Entrez and look at it in
Sequin. However, you can only perform a formal database update only
those records which you have previously submitted yourself.
**Performing a Medline lookup:
#In its network-aware mode, Sequin can
import the relevant sections of a Medline record directly into a
sequence submission record. Rather than typing in the entire citation,
you can enter minimal information, such as the Medline Unique Identifier
(MUID), or Journal name, volume, year, and pages. The
Medline lookup
is explained in the section of the documentation entitled Publications.
**Performing a Taxonomy lookup:
#In its network-aware mode, Sequin can look
up the taxonomic lineage of an organism from the NCBI's taxonomy
database. This lookup is normally performed by the NCBI database staff
after the record has been submitted to GenBank. If you look up the
taxonomy before submitting the sequence, you can make a note in the
record of any disagreements. The
taxonomy lookup
is explained in the in the section of the documentation covering
Biological Source: Organism page: Lineage subpage.
**Accessing the NCBI DeskTop:
#The NCBI DeskTop displays the internal
structure of the record being viewed in Sequin. The
DeskTop
is explained under the Misc menu.
*Entrez Query
#This option allows you to perform a query against the NCBI's
Entrez database.
http://www.ncbi.nlm.nih.gov/Entrez
#If you have downloaded a sequence from Entrez, it will have the Entrez
neighbor buttons at the bottom of the window. To see similar nucleotide
sequences, select Nucleotide in the Target pop-up menu, and then click
on the Neighbor button to the left to get the Entrez list of related
sequences. To see the Entrez records for any publications or CDSs in the
record, select the Medline or Protein database, and click on the Lookup
button. Any associated Genome or Structure records can also be viewed.
*NCBI DeskTop
#This option is only available if you are running Sequin in its
network-aware
mode.
#The NCBI DeskTop provides a view of the internal structure of the
Sequin record, the ASN.1. Its display resembles a Venn diagram, and
represents all the structures represented in the ASN.1 data model.
#In addition, a number of undocumented software tools from the NCBI can
be accessed from the DeskTop. These tools are components of the NCBI
portable software toolkit. You can also customize these functions using
the toolkit with your own software tools. The toolkit and its
documentation are available from the NCBI by anonymous
FTP.
#The DeskTop should only be used by very seasoned users. At this time,
we are not providing any documentation for these specialized functions.
>Annotate Menu
#This menu allows you to enter features and descriptors on the sequence.
#The first six options, Genes and Named Regions, Coding Regions and
Transcripts, Structural RNAs, Bibliographic and Comments, Sites and
Bonds, and Remaining Features refer to types of Features that can be
added to the sequence. Features are described in more detail in the
above section entitled
Features.
#The seventh option, Publications, allows you to add a Publication Feature
or Publication Descriptor to the record. Publications are described in
more detail in the above section entitiled
Publications.
#The eighth option, Descriptors, allows you to add Descriptors to the
record. Descriptors are described in more detail in the section
entitled
Descriptors,
above.
#The ninth option Generate Definition Line, will generate an title for your
sequence based on the information provided in the record. This option will
work
for single sequences as well as sets of sequences, and can handle complex
annotations with multiple features. The title will follow
GenBank conventions, but may be modified by the database staff if it is not
appropriate. The title you enter here will replace any title you entered
elsewhere in the submission, for example, any title which was attached to the
nucleotide sequence. For a description of definition lines, see
Nucleotide Definition line (title)
, above.
>Options Menu
*Font
#Use this item to change the display font. From the pop-up menus,
choose the style and size of type. For additional changes, mark the
Bold, Italic, or Underline check boxes. The default font is 10 point
courier.
*Legend
#Enabled only in the Graphic view, it shows what the various kinds of features
used in the picture look like, i.e., what colors and styles and fonts each one
uses.
>Sequence Editor
#This editor allows you to modify the nucleotide or amino acid sequences
in your entry. For example, you can add or remove nucleotides, or you
can add or remove CDS (coding sequence) features from the entry.
#Even though the Sequence Editor does allow you to undo changes you make
to the sequence, we strongly suggest that you save a copy of the entry
before launching the Sequence Editor so that you can revert to it if
necessary.
*Starting the Sequence Editor
#The sequence which appears in the editor is dependent on the
sequence(s) selected in the Target Sequence pop-up menu. There are two
ways to launch the sequence editor for nucleotide sequences. First, you
can double click within sequence in any display format of the record
viewer. A window containing the DNA sequence will appear. Second, in
the record viewer, select the sequence you wish to edit in the Target
Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You
can launch the editor for protein sequences in two ways also. If you
select the protein sequence in the Target Sequence pop-up menu, double
click within the protein sequence. A window containing the protein
sequence will appear. If you select a nucleotide sequence in the Target
Sequence pop-up menu, double click within the CDS (coding sequence)
feature to launch the Coding Region feature form (see
Features
in the Sequin help documentation). Click on "Launch Product Viewer" to
start the sequence editor. Both methods of accessing the protein
sequence editor will result in the same display window.
*Moving around the Sequence Editor
#The cursor can be moved with the mouse or the arrow keys. The display
window will change to show the position of the cursor. The sequence
location of the first residue on each line is indicated on the left side
of the window. The cursor location, or the range of sequences selected
by the mouse, is shown in the upper left corner of the window. If you
want to move the cursor to a specific location, type the number in the
box on the top left of the sequence editor window, and hit the Go to
button. If you want to look at a specific sequence, but not move the
cursor to it, type the number in the upper right box of the window and
hit the Look at button.
*Editing sequence
#Select a piece of sequence by highlighting it with the mouse. To
select the entire sequence, click on a sequence location number on the
left side of the window. Any sequence that is highlighted in the Sequence
Editor
will show up as a box on the sequence when it is viewed in the Graphic
Display Format.
#One way to insert and delete residues is with the mouse. Move the
cursor to the appropriate location and type. Text will be inserted to
the left of the cursor. Delete sequence with the backspace or delete
key. Text will be deleted to the left of the cursor. To delete a block
of sequence, highlight it with the mouse and use the delete or backspace
key.
#Another way to insert and delete residues is with options under the
Edit menu of the Sequence Editor. Use Cut to remove, or Copy to copy,
highlighted residues. Paste these sequences anywhere. Use Clear to
permanently remove highlighted residues.
#To save changes you have made to the sequence, press the Accept button at
the bottom of the Sequence Editor display window. If you do not wish to
save the changes, press the Cancel button at the bottom of the Sequence
Editor display window. Selecting either Accept or Cancel will quit the
Sequence Editor and return you to the record viewer. Please note that
any changes you make will not become a permanent part of the Sequin
record until you Save the record in the record viewer. The Save button
at the bottom of the Sequence Editor display window is used only to save
a CDS feature.
*Changing the display
#The default sequence displayed for a nucleotide sequence is the coding
strand. If you wish to see the complement of this sequence, that is, if
you wish to see the double stranded version of this sequence, select
Complement under the Sequence Editor View menu. You can also elect to
see the translation of the top stand. Select Reading Frames + under the
Sequence Editor View menu to see the three phase translation of the
upper (coding) nucleotide strand. Select Reading Frames - under the
Sequence Editor View menu to see the three phase translation of the
lower (noncoding) nucleotide strand. Methionine residues are colored.
Complement, Reading Frames +, and Reading Frames - can be selected
simultaneously or individually.
#Only the top nucleotide strand can be edited. Any changes made in this
strand are reflected in the Complement as well as in the Reading Frames.
*Editing a CDS (coding sequence)
#A powerful feature of the Sequence editor is that it allows you to make
new CDS (coding sequence) features on the nucleotide sequence. To make
a new CDS feature, select the residues, and choose Features-->Coding
Regions and Transcrips-->CDS. This action launches the CDS editor. The
location of the highlighted sequenced will have been automatically filled
out in the Location page. Visit the Location page, enter the protein name
on the Coding Region-->Protein subpage, and press Accept. Select "Show
Features"
at the bottom of the Sequence Editor to see the CDS as a colored bar.
The CDS can be selected by clicking either on it or on its
name in the left margin. To remove a CDS, select it and click on
Clear under the Sequin Edit menu. Click on yes when Sequin asks if you
want to delete the associated protein product.
#You can also have Sequin find coding sequences for you by using the ORF
Finder, located under the Search menu of the record viewer. Click on
ORF Finder to find the ORFs (open reading frames) in your sequence. The
ORF Finder is described in more detail
above.
In the ORF Finder, click on the ORF you want to add the the sequence.
This ORF will be highlighted on the sequence when it is viewed in the
sequence editor. You can then make the sequence into a CDS by following
the above instructions.
Coding Region
(CDS) feature form. At minimum, enter the name of the protein on the
Protein subpage of the Coding Region page. For more detailed
instructions, see the CDS feature, above. After you click Accept on the
Coding Region form, Sequin will accept the CDS as a new feature, and the
record viewer and other windows will be brought up to date. The color
of the CDS will change to pink. A graphical representation of features
can be seen by selecting the Graphic Display Format in the record viewer.
#Saved CDS features can also be edited. You can alter the length or
location of a saved CDS as described above. However, a saved CDS cannot
be removed in the Sequence Editor window. To remove a saved feature, go
the the Graphic Display Format of the record viewer, select the CDS, and
choose Clear under the Edit window.
#When you add or remove nucleotide sequence in a region within a CDS,
you can choose whether the CDS should be interrupted by these changes.
On the main Sequin window, select Split feature mode to have the CDS
interrupted by the inserted or deleted sequence. Select Merge feature
mode to have the CDS incorporate the changed sequence.
*Working with sets of aligned sequences
#Sequin allows you to work with aligned sets of closely related
nucleotide sequences which are part of a population, phylogenetic, or
mutation study. If the sequences are imported in a pre-aligned format,
such as PHYLIP, Sequin uses this alignment. If the sequences are
imported individually in FASTA format, Sequin can generate its own
alignment.
#You can view the aligned sequences in the Sequence Alignment Editor. In
the record viewer, select All Sequences in the Target Sequences menu,
and select the Alignment Display Format. Highlight the alignment by
clicking inside of the box surrounding the sequence bars. Then select
Edit alignment from the Edit menu. The aligned sequences can be viewed
in a number of different formats. See instructions for the Sequence
Editor Alignment menu,
below.
#If you imported a set of nucleotide sequences, you may want to add a
CDS (coding sequence) feature to one or more of the sequences. You must
first add the CDS feature to a single sequence (see Editing a CDS,
above
). In order to access the Sequence Editor for a single sequence, double
click on the name of that sequence in the Alignment view.
You can then propagate the feature to other sequences (
see Feature Propagate
under the Edit menu
).
*Creating new alignments
#Sequin also allows you to import sequences and align them either
with an existing alignment or with a single sequence. Features
can be propogated between aligned sequences. Sequences can either
be in a file or in Entrez (see Sequence Editor File menu, below).
*Sequence Editor File menu
**Read Sequence File
#Imports FASTA formatted sequence(s) or ASN1 records
from a file.
Three alignment methods are available. BLAST provides the best local
alignment;
BLAST with extensions provides a global alignment anchored by the BLAST
local alignment; Global Alignment uses a dynamic programming algorithm to
provide a different global alignment.
**Download from Entrez
#Imports one sequence from Entrez using the accession
number or gi.
**Import Alignment
#Imports sequence alignments in Phylip, NEXUS, and FASTA+Gap
format. The first sequence in the file have the identical sequence and
Sequence Identifier as the sequence in the record.
**Export
#Exports single sequences in Text or FASTA format, and alignments in
FASTA+Gap, Phylip, or ASN1 format. This function allows you to choose the
range of the sequence to export.
**Accept Changes
#Closes the Sequence Editor, committing all changes made in the
Sequence Editor. To save the changes, select File-->Save in the main Sequin
menu.
**Cancel
#Cancels the Sequence Editor without committing any changes.
*Sequence Editor Edit menu
**Undo
#Undoes all actions performed in the Sequence Editor since the last save.
**Cut
#Removes the highlighted sequence. This sequence can be pasted elsewhere.
**Paste
#Pastes a cut or copied sequence to the right of the cursor.
**Copy
#Copies the highlighted sequence. This sequence can be pasted elsewhere.
**Refresh
#Refreshes window by reloading the data. Note that this option does not
undo any editing.
**Delete Sequence
#For alignments, deletes the selected sequence.
*Sequence Editor View menu
**View mode
#Allows viewing of the sequence, only.
**Edit mode
#Allows editing of the sequence
**Label
#Allows you to change how the Sequence Identifiers are displayed.
Normally, sequence identifiers are only displayed for aligned sequences.
If the sequences have been downloaded from Entrez, and have different
names in their definition lines, you can change which name you see. You
can view each sequence labelled by the following names: FASTA short,
FASTA long, Locus, Accession, or Report.
**Font
#Choose font
**Preferences
#Allows you to change the style of the display, including the colors,
font type, and font size.
**Complement
#Shows the complement of the submitted strand underneath the original.
**Reading frames
#Shows the indicated phase translation of the selected coding sequence.
You can select any or all of the six reading frames.
**Translation Style
#Allows you to choose between three styles in which to view the coding
sequence translation. The default style is to see all amino acids. If
you select the *** option, Sequin will display all methionine residue as
M and all stop codons as *. If you select the orf option, Sequin will
show all open reading frames by connecting the M and * in a single
reading frame with a ~.
**Find
#The Find command allows you to find DNA or amino acid sequence patterns
in your sequence. The search is case insensitive. To find an exact
match to a DNA sequence pattern, type the pattern in the box. You can
also specify non-exact patterns. To find the reverse complement of the
pattern, click on the box. For example,
#TCAGGGC finds the sequence TCAGGGC
#[TCA]CAGGGC finds T or C or A followed by CAGGGC
#NCAGGGC finds T or C or G or A followed by CAGGGC
#TCA(3)GC finds the sequence TCAGGGC
#TCA(1:3)GC finds the sequences TCAGC, TCAGGC, and TCAGGGC
#TCA(1:3)NC finds the sequence TCA, followed by 1-3 occurrences of
G,A,T,or C, followed by C, i.e., TCATC or TCATTC or TCAATGC
#To find an exact match to an amino acid sequence pattern, type that
sequence in the box, and click on "translate sequence". Sequin will
look for all occurences of that pattern in all three plus strand open
reading frames. The open reading frames will be shown, and the DNA
sequence encoding that protein sequence will be highlighted. You can
also specify non-exact patterns. For example,
#CDLPEYC finds the sequence CDLPEYC
#[CRQ]DLPEYC finds C or R or Q followed by DLPEYC
#XDLPEYC finds any amino acid followed by DLPEYC
#CDL(3)EYC finds the sequence CDLEEEYC
#CDL(1:3)PE finds the sequences CDLPE, CDLPPE, and CDLPPPE
#CDL(1:3)XE finds the sequence CDL, followed by 1-3 occurrences of any
amino acid, followed by E, i.e., CDLAAE, CDLRSE, or CDLAPQE
***Find previous
#Find the previous occurrence of a pattern.
***Find next
#Find the next occurrence of a pattern.
*Sequence Editor Features menu
#the Features menu changes depending whether you are viewing a single sequence
or
a set of aligned sequences.
#If you are viewing a single sequence, the menu contains a long list of all
features that can be annotated on a sequence. These features are the same as
those that are accessible through the main Sequin Annotate menu.
#You can annotate features either in the Annotate menu or in the Sequence
Editor.
If you annotate them in the Annotate menu, you must provide the nucleotide
sequence location of the feature. However, if you add features from the
Sequence
Editor, you do not need to know their nucleotide coordinates. Simply highlight
the sequence which the feature covers, and the location of the sequence will be
automatically entered in the feature location box. Additional explanations of
how to annotate features are provided in the section on
Features.
*Sequence Editor Alignment menu
#Theses menu choices are only available when an alignment is being
edited. Alignments can be generated when a set of sequences from a
phylogenetic, population, or mutation study is submitted. They can also
be made by importing additional reference sequences into Sequin with the
Align with
option under the Sequence Editor Edit menu.
**Select Reference
#Select which of the aligned sequences should be the master sequence.
Click on the desired sequence in the sequence editor, then choose Select
master to change the display. By default, the master sequence is the
first sequence listed. The Sequence Identifier of the master sequence
is indicated in color.
**Select all
#Select all nucleotide sequences.
**Show substitutions/Show all
#Changes the way the sequences are displayed. When Show all is selected
(that is, Show substitutions is visible), the entire sequence of each
entry is displayed. When Show substitutions is selected, the entire
sequence of the master sequence is shown. The sequences of the aligned
entries are shown as dots where they are identical to the master
sequence, and letters where they are different.
**Select Variations/Conservation
#Use Select Variations to highlight positions at which the sequences are
different from the Reference. Use Conservation to highlight positions that
are different from the Reference.
**Dot Matrix
#This option shows the result of a dot matrix plot between two selected
sequences in the alignment. It is under development.
*Sequence Editor window buttons
**Go to
#Moves the cursor to the indicated location.
**Look at
#Moves the window to the indicated location without moving the cursor.
**Merge feature mode/Split feature mode
#In merge mode, any new sequence which is entered into a region spanned
by an existing feature becomes part of that feature. For example, if
you enter new sequence in the middle of a CDS, that sequence will be
translated as part of the CDS. In split mode, the new sequence
interrupts the feature. For example, if you enter new sequence in the
middle of a CDS, the CDS will be interrupted by that sequence (see the
location of the CDS in the record viewer).
**Hide feat./Show feat.
#This box toggles between hiding and showing the features on a sequence.
To hide the features, click on the box when it is called Hide feat. To
show features, click on the box when it is called Show feat.
**Refresh
#Refreshes the Sequence Editor window by reloading the data. This
option does not undo any editing.
**Accept
#Closes the Sequence Editor after saving all of the changes made to
sequences and features.
**Cancel
#Closes the Sequence Editor without saving any changes made to sequences or
features.