Sequin Help Documentation
Sequin Entrez BLAST OMIM Taxonomy Structure

 

Table of Contents


>Introduction #Sequin is a program designed to aid in the submission of sequences to the GenBank, EMBL, and DDBJ sequence databases. It was written at the National Center for Biotechnology Information, part of the National Library of Medicine at the National Institutes of Health. This section of the help document provides a basic overview of how to submit sequences using the Sequin forms. Subsequent sections provide detailed instructions for entering information on each form. *The help documentation #The Sequin help documentation is available in both on-line and World Wide Web (http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html) formats. The text of the on-line version scrolls as you progress through the Sequin forms. Specific words or phrases can be identified with the "find" command at the top of the window. The on-line document can also be saved as a text file, or printed directly to a printer. Click on the window which contains the help documentation. Under the Sequin File menu, choose Export Help... to save the documentation as a text file. To print the documentation without saving it first, click on the help window, and choose Print from the Sequin File menu. *Organization of Forms #Information is entered into Sequin on a number of different forms. Each form is made up of pages which are indicated by folder tabs at the top of the form. You can move to the desired page by clicking on the appropriate folder tab. You can also move between pages of a form by clicking on the "Next page" or "Prev page" buttons at the bottom of the screen. You can move to the previous form or the next form by clicking on the "Prev form" or "Next form" buttons on the first or last pages of a form, respectively. #There are two levels of folder tabs. Tabs with large bold lettering indicate pages which should be filled out for every entry. Tabs with smaller lighter lettering indicate minor pages which provide access to infrequently used parameters. #There are numerous ways to enter information onto a page of a form. Many of these, such as text fields, radio buttons, check boxes, and scrolling boxes, are standard in other computer programs and will not be described here. Sequin does employ two less standard data entry options, pop-up menus and spreadsheets. #Pop-up menus: When the mouse is clicked in one of these menus, a list of choices is displayed. Select the correct option by moving the mouse to that option and letting go. Only one option can be selected. #Spreadsheets: These are fields which change their size in response to the amount of information entered. After you input information into a field, another field will appear in which you can enter additional information if necessary. *Overview of Sequin #If you are using Sequin for the first time, you will be prompted to fill out four forms: the Welcome to Sequin form, the Submitting Authors Form, the Sequence Format form, and the Organism and Sequences Form. After you have filled out these forms, a window will appear which contains the Sequin record viewer. This viewer allows you to access many other forms in which you can edit fields filled out in the three initial forms, as well as add additional information you feel should be included in the submission. Detailed instructions on how to fill out the forms and use the record viewer is presented below. >Welcome to Sequin Form #First, indicate with one of the three radio buttons whether you are submitting the sequence to the GenBank, EMBL, or DDBJ database. If you are working on a sequence submission for the first time, click on "Start New Submission." If you are modifying an existing submission record, click on "Read Existing Record." If you would like to quit from Sequin, click on "Quit Program." #You can also "Read Existing Record" to read in a FASTA-formatted sequence file for analysis purposes. The sequence will be displayed in Sequin and can be analyzed with tools such as CDD BLAST, but it should not be submitted since it does not have the appropriate annotations. #If you are running Sequin in its network-aware mode, you will see another button labelled "Download from Entrez." This option allows you to update an existing database record using Sequin. The record will be downloaded from GenBank into Sequin using the NCBI's Entrez retrieval system. The contents of the record will appear in Sequin, and you can edit them by updating the sequence or the annotations, as necessary. If you do not see the button labelled "Download from Entrez" on the Welcome to Sequin form, you are not running Sequin in its network-aware mode. To make Sequin network-aware, see the instructions later in the help documentation. #You can update only those records which you have submitted, not those submitted by others. To update an existing record, first select which of the databases you will be sending the update to. This should be the database to which the original record was submitted. If you do not know which database to use, send the record to GenBank and the NCBI staff will forward it to the appropriate database. Next, click on the button "Download from Entrez." Enter the accession number or GI of the sequence on the first form. Then enter "yes" if you are planning to submit the record as an update to one of the databases. Fill out the Submitting Authors form. Instructions for this form are found in the Sequin help documentation under "Edit Submitter Info" under the Sequin File menu. The record will then open in Sequin. Explanations of how to add annotations or update sequences are presented in the documentation entitled "Editing the record" and "Sequence Editor" respectively. You will not see the Submitting Authors Form, the Sequence Format Form, or the Organism and Sequences Form. Note that updates, as well as new records, must be emailed to the appropriate database. Sequin does not support direct submission of records over the Internet. #Additional configuration options are available under the Misc menu. First, you can toggle between the stand-alone and network aware modes of Sequin. The default mode of Sequin, which is sufficient for most sequence submissions, is stand-alone. In its network aware mode, Sequin can exchange data with the NCBI and, for example, retrieve sequences from Entrez and perform BLAST searches. The network aware mode of Sequin is described in detail in the Net Configure section below. Second, if you are running Sequin in its network aware mode, you can query NCBI's Entrez database. Further information about how to query Entrez is available. http://www.ncbi.nlm.nih.gov/Entrez. Third, you can start the NCBI DeskTop. The DeskTop, which is for advanced Sequin users only, is described below. >Submitting Authors Form #Information from this form will be used as a citation for the sequence entry itself. It can contain the same information found in citations associated with the formal publication of the sequence. #On the bottom of each form are two buttons. Click "Prev form" (first page in a form) or "Prev page" (subsequent pages in a form) to go to the previous form or page. Click "Next Form" (last page on a form) or "Next Page" (earlier pages on a form) to move to the next form or page. #Form pages can also be saved individually by using the "Export" function under the File menu. If you are processing multiple submissions, you can use the "Import" function under the File menu to paste previously entered information directly on the page. #The Contact, Authors, and Affiliation pages can be saved as a block so that you can use this information for your next submission. For your first Sequin submission, fill in the requested information on the Submitting Authors form, and proceed with the preparation of the submision. In the record viewer, when the submission is basically finished, click on "Edit Submitter Info" under the Edit menu. Under the file menu in the resulting Submission Instructions form, click on Export Submitter Info to save the information to a file. For subsequent Sequin submissions, if you have already saved the submittor information, click on Import Submitter Info under the File menu on the Submission page of the Submitting Authors form. You must still fill in the manuscript title on the Submission page though. *Submission Page **May we release this record before publication? #Please select one of the two radio buttons. If you select "Yes," the entry will be released to the public after the database staff has added it to the database. If you select "No," fields will appear in which you can indicate the date on which the sequences should be released to the public. The submission will then be held back by the database staff until formal publication of the sequence or GenBank Accession Number, or until the Release Date, whichever comes first. **Tentative title for manuscript #Please enter a title which appropriately describes the sequence entry. This is a title for the sequence submission, and you may or may not want it to be the same as the title of an article in which the sequence is described. Later in the submission process, you will have the opportunity to change this information and add references from published or in press works which describe the sequence. *Contact Page #Please enter the name, telephone and fax numbers, and e-mail address of the person who is submitting the sequence. This is the person who will be contacted regarding the sequence submission. This person does not have to be on the list of authors involved in the sequencing. The phone, fax, and e-mail address will not be visible in the database record. *Authors Page #Please enter the names of the people who should receive scientific credit for the generation of sequences in this entry. The person on the Contact page is automatically listed as the first author. This information can be changed if necessary. The author names should be entered in the order first name, middle initial, surname. You can add as many authors to this page as you wish. After you type in the name of the third author, the box becomes a spreadsheet, and you can scroll down to the next line by using the space bar. *Affiliation Page #Please enter information about the principal institution where the sequencing was performed. This is not necessarily the same as the workplace of the person described on the Contact page. This information will show up in the reference section of the record, with the title Direct Submission. >Sequence Format Form #Use this form to indicate the type and format of sequence you are submitting. #Sequin can process single nuceotide sequences as well as sets of related sequences. If the sequences are related in terms of coming from the same publication, or the same organism, they may be candidates for a Batch submission. Biologically-related sequences may be classified as environmental samples, polulation, phylogenetic, mutation, or segmented sets as appropriate. Segmented sets consist of a collection of non-overlapping sequences covering a specific genetic region. In all cases, although the sequences are handled as a single submission, each sequence in a set will receive its own database accession number and can be annotated independently. #Sequin can display the alignments of sequences which are submitted as part of an aligned phylogenetic, population, mutation set or environmental samples. Such sequences can be submitted in FASTA, Contiguous (FASTA+GAP, NEXUS, MACAW), or Interleaved (PHYLIP, NEXUS) formats. If the sequences are in FASTA format, Sequin can generate an alignment. If the sequences have already been aligned in FASTA+GAP, PHYLIP, MACAW, or NEXUS, Sequin will not change the alignment. If one of the sequences in your alignment is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new accession number. Instead of supplying that sequence with a new Sequence Identifier, give it the identifier accU12345, where U12345 is the accession number of the sequence. #Single sequences, segmented sequences, and batch submissions must be submitted in FASTA format. *Submission type #Use the radio buttons to indicate which of the following type of submissions you are creating: #-Single sequence: a single mRNA or genomic DNA sequence. If you are submitting multiple sequences from the same publication, consider a Batch Submission. If you decide to submit multiple Sequin files, each with one or more sequences, please send each file in a separate email message. #-Segmented sequence: a collection of non-overlapping, non-contiguous sequences which cover a specified genetic region. A standard example is a set of genomic DNA sequences which encode exons from a gene along with fragments of their flanking introns. If the segmented set is part of an alignment, however, select the appropriate Population, Phylogenetic, or Mutation study button. #-Population study: a set of sequences which were derived by sequencing the same gene from different isolates of the same organism. #-Phylogenetic study: a set of sequences which were derived by sequencing the same gene from different organisms. #-Mutation study: a set of sequences which were derived by sequencing multiple mutations of a single gene. #-Environmental samples: a set of sequences which were derived by sequencing the same gene from a population of unclassified or unknown organisms. #-Batch submission: a set of related sequences which are not part of a population, mutation, or phylogenetic study. The sequences should be related in some way, such as coming from the same publication or organism. You should plan that all sequences will be released to the public on the same date. *Sequence data format #Use the radio buttons to select one of the data formats. If you are submitting a single or segmented sequence, or a batch submission, your sequence must be in FASTA format, described below. If you are submitting a set of sequences as part of a population, phylogenetic, or mutation study, you have a choice of sequence formats. You may submit the set as individual sequences in FASTA format. However, if your sequences are already aligned, you can submit the sequences as part of an alignment. Sequin currently accepts the alignment formats FASTA+GAP, PHYLIP, MACAW, NEXUS Interleaved, and NEXUS Contiguous. All formats are described in the Nucleotide Page , below. >Organism and Sequences Form #This form is made up of three pages. On the Organism page, you indicate the organism from which the sequence derives. However, as explained below, in the case of a set of sequences submitted as part of a phylogenetic study, the organism is indicated either in the sequence file itself or on the following Source Modifiers form. The second page, the Nucleotide page, prompts you to import the nucleotide sequence(s) into Sequin from a separate file. The identity of the third page changes depending on the submission type indicated on the previous Sequence Format page. If you are submitting a single or segmented sequence, this page is a Protein page, which prompts you to import the relevant amino acid sequence. If you are submitting a population, phylogenetic, or mutation study, this page is an Annotation page, which allows you to add certain annotations to your nucleotide sequence. *Organism Page #Information about the organism from which the sequence was derived should be entered on this page. Alternatively, for any type of submission, the name of the organism, as well as additional information, can be indicated instead in the file which contains the nucleotide sequence. Indeed, if you are submitting a set of sequences for a phylogenetic study, you will not be able to fill out any information on the Organism page. Instead, you must indicate the organism names in the sequence file or on the following Source Modifiers form. A detailed description of how to format this organism information is presented in the documentation for the Nucleotide Page , below. **Organism #The scrollable list contains the scientific names of many organisms. To reach a name on the list, type the first few letters of the scientific name into the appropriate field. The list will scroll to the appropriate place, and you can select the organism. When you choose a name from the list, the Scientific Name and the Genetic Code for Translation fields are filled out automatically. If there is a common name for the organism, the Common Name field will be filled out as well. You can also use the space bar to reach the appropriate part of the list. If you have any questions about the scientific or common name of an organism, see the NCBI taxonomy browser http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html #If the name of the organism is not on the list, type it in directly. If you do not know the scientific name, please be as specific as you can, and include a unique identifier, such as a clone, isolate, strain or voucher number or cultivar name, e.g.: Nostoc ATCC29106, uncultured spirochete Im403, Lauraceae sp. Vásquez 25230 (MO), Rosa hybrid cultivar 'Kazanlik'. Also, if applicable, indicate if the name is unpublished as of time of submission. Additional information like subspecies, strain, isolates, or serotype can be entered later in the submission process. **Location of Sequence #From the selection list, please enter the location of the genome which contains your sequence. Most entries will have a "Genomic" location. The following is a brief description of the choices in this pop-up menu: #-Genomic: chromosome. This category includes mitochondrial and chloroplast proteins which are encoded by the nuclear genome. #-Chloroplast: a chlorophyllous plastid. #-Chromoplast: a non-chlorophyllous, pigmented plastid, found in fruits and flowers. #-Kinetoplast: a specialized type of mitochondrion found exclusively in Kinetoplastida (e.g., Leishmania). NOTE: 'kinetoplast' should be applied ONLY to members of the Kinetoplastida (trypanosomes and bodonids). #-Mitochondrion: a semi-autonomous, self-reproducing organelle that occurs in the cytoplasm of most eukaryotic cells #-Plastid: any of a class of double membrane-bound, light-harvesting organelles (or derived from same). NOTE: 'plastid' should be used ONLY when a more precise term, e.g., chloroplast, is not applicable. #-Macronuclear: a specialized type of nucleus found exclusively in the ciliated protists (e.g., Tetrahymena). NOTE: 'macronucleus' should be applied ONLY to members of the Ciliophora. #-Extrachromosomal: other extrachromosomal elements not listed here, such as a B chromosome or an F factor. #-Plasmid: extrachromosomal genetic element found in bacterial species. Note this does not include the cloning vector used to propagate the sequence of interest. #-Transposon: transposable element flanked by repeat sequences containing genes in addition to those needed for insertion #-Insertion sequence: simple transposable element carrying repeat sequences containing a transposase gene #-Cyanelle: a specialized type of plastid found exclusively in glaucocystophytes (e.g., Cyanophora). NOTE: 'cyanelle' should be applied ONLY to members of the Glaucocystophyceae. #-Proviral: a virus that is integrated into a host cell chromosome #-Virion: a completed virus particle #-Nucleomorph: a reduced nuclear remnant found in Chlorarachniophyceae (e.g., Chlorarachnion) and Cryptophyta (e.g, Cryptomonas). NOTE: 'nucleomorph' should be applied ONLY to members of the Chlorarachniophyceae or Cryptophyta. #-Apicoplast: a reduced plastid characteristic of apicomplexans (e.g., Plasmodium). NOTE: 'apicoplast' should be applied ONLY to members of the Apicomplexa. #-Leucoplast: a plastid lacking pigments of any type. #-Proplastid: an immature plastid. #-Endogenous_virus: a virus that has integrated permanently into the host genome, and which is inherited vertically through the germ-line of the host. **Genetic Code for Translation: #If the submission type was Phylogenetic study, this field will read "Default Genetic Code." Please use this field to select the genetic code which should be used to translate the nucleic acid sequence. The genetic code for a eukaryotic organism is "Standard". If you selected a scientific organism name from the scrollable list described above, this field was filled out automatically. If you encode the organism name directly in the first line of the file which contains your sequence, Sequin will fill out this field automatically after your sequence is imported. However, if the organism is not among the top 500 organisms represented in GenBank, this field will not be filled out automatically, and you must select the genetic code. #For more information regarding the translation tables available, see the NCBI taxonomy page . http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c *Nucleotide Page #The nucleotide sequence(s) and associated descriptive information are entered on this page. Sequin can also interpret the name of the organism, strain, chromosome, and many other modifiers which are encoded on the first line of the file which contains the nucleotide sequence. #If you are submitting sequences as part of a phylogenetic, mutation, population study, or environmental samples set, you may indicate the organism, strain, chromosome, and other modifiers in one of two places. This information can be encoded in the file which contains the sequence. Alternatively, you can enter the information on the Source Modifiers form which follows the Organism and Sequences Form. #If you are submitting a set of aligned sequences, and one of those sequences is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new accession number. Instead of supplying that sequence with a new Sequence Identifier, give it the identifier accU12345, where U12345 is the accession number of the sequence. **Molecule #A database sequence can represent one of several different molecule types. Enter in the Molecule pop-up menu the type of molecule that was sequenced. #-Genomic DNA: Sequence derived directly from the DNA of an organism. Note: The DNA sequence of an rRNA gene has this molecule type. #-Genomic RNA: Sequence derived directly from the genomic RNA of certain organisms, such a viruses. #-Precursor RNA: An RNA transcript before it is processed into mRNA, rRNA, tRNA, or other cellular RNA species. #-mRNA[cDNA]: A cDNA sequence derived from mRNA. #-Ribosomal RNA: A sequence derived from the RNA in ribosomes, for example, the sequence of a cDNA derived from rRNA. #-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for example, the sequence of a cDNA derived from tRNA. #-Small nuclear RNA: A sequence derived from small nuclear RNA, for example, the sequence of a cDNA derived from snRNA. #-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA, for example, the sequence of a cDNA derived from small cytoplasmic RNA. #-Other-Genetic [plasmid]: A sequence that is not normal genetic material but that is also is not a transcription product. Examples include plasmids, B chromosomes, and F factors. **Topology #Please choose the topology of the molecule, either Linear or Circular, from the pop-up menu. Most sequences have linear topology. Select Circular if the sequence is complete and it has a circular topology, for example, it is a plasmid or a complete mitochondrial genome. **Incomplete at 5' end/Incomplete at 3' end #If the sequence is incomplete at the 5' or 3' end, please check the appropriate box. If a complete sequence is entered, for example, the complete coding sequence of a gene, do not check either box. **FASTA def line starts with sequence ID #This box will not be visible if you selected Interleaved or Contiguous format on the Sequence Format form. #We suggest that for standard simple submissions you follow the instructions below for how to create a nucleotide sequence in FASTA format. In FASTA format, the line preceding the lines of sequence consists of a ">" sign, followed by some descriptive information. If you follow the instructions, and the line immediately above your sequence reads #>SeqID [org=organism scientific name] title #check this box. The unique sequence identifier for the sequence will be the word which immediately follows the ">". #If you have not included a SeqID, leave this box unchecked, and Sequin itself will assign a unique sequence identifier. However, be sure that the first line of descriptive information starts with a ">". **FASTA format for nucleotide sequences #The sequence(s) which you will be submitting should be located in another file; you cannot directly type sequence data into this page. The sequence(s) must be in a certain format, called the FASTA format. Each line of sequence should be no longer than 80 characters. #Note: If you are submitting multiple sequences as part of a phylogenetic, population, mutation study, or environmental samples set, each sequence must be in FASTA format. However, it does not matter if the sequences are in one file or separate files on your computer. You can encode information about the sequence, such as the organism, chromosome, or strain, in the file that contains the sequence, as described below. Alternatively, this information can be added on the Source Modifiers form which follows the Organism and Sequences Form. #The line directly above the sequence (the first line in the file, for a single sequence) should read #>SeqID [org=organism scientific name] [modifier=modifier name] title #for example, !>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Human breast and ovarian cancer susceptibility (BRCA1) mRNA, complete cds. #->: The ">" sign must precede any descriptive information about your sequence. Any line which does not begin with a ">" sign will be interpreted as a line of nucleotide sequence. #-SeqID: A unique sequence identifier which you give your sequence. This field is required only if you have checked the box on the Nucleotide page entitled "FASTA def line starts with sequence ID." This name must be different from the name which you give to other nucleotide or protein sequence(s). If you do not include an identifier here, Sequin will create one for you. The identifier will be changed to an accession number by the database staff later in the submission process. If you are submitting a set of aligned sequences, and one of those sequences is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new accession number. Instead of supplying that sequence with a new SeqId, give it the identifier accU12345, where U12345 is the accession number of the sequence. #-[org=organism scientific name]: This field gives you the opportunity to indicate the name of the organism directly on the sequence file. You must indicate the name of the organism here if you are submitting sequences as part of a phylogenetic study. For other types of submissions, you may indicate the organism name either with this field or by filling out the previous Organism page. You must enter the complete scientific name (no abbreviations). The field must be written as shown, complete with brackets. Do not put spaces around the "=". Some common examples include [org=Homo sapiens], [org=Mus musculus], [org=Saccharomyces cerevisiae], and [org=Drosophila melanogaster]. The NCBI maintains a taxonomy database with information about scientific and common organism names http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html #-[modifier=modifier name]: Additional modifiers can also be encoded on the first line of the nucleotide sequence. These modifiers include moltype, molecule, chromosome, map, clone, tissue-type, strain, and specimen-voucher. A complete list and descriptions of these modifiers can be found in the Source and Organism subpages of the Biological Source Modifiers page. You may include as many modifiers as you like, but each must be bounded by a set of brackets. The name of the modifier must be written exactly as shown in the list above. An example of a string of modifiers is [strain=BALB/c] [chromosome=5] [sex=male] [tissue-type=testis][moltype=mRNA]. Modifiers can also be added as Biological Source descriptors or features later in the submission process. #-[lineage=lineage]: If you are working with an organism whose lineage is not listed in the NCBI taxonomy database, you can provide the complete lineage here. #-title: A definition or description of the sequence. Sequin can create titles automatically, using the Generate Definition Line function under the Annotate menu. Titles can be edited later in the submission process by selecting Descriptors-->Title, under the Annotate menu in the record viewer, described below. Choose the title carefully, as it will become the Definition line of your submission. If you are submitting a set of sequences from a phylogenetic, population, mutation study, or environmental samples set, you can leave this field blank. You can instead add the sequence titles on the Annotation page below. **Nucleotide Definition line (title) #Nucleotide definition lines, or titles, follow a structured format. For an entry which includes a coding region, the definition would be in the format: #Genus species Protein name (gene symbol) mRNA/gene, complete/partial cds #However, the general format does not cover all possible Definition lines, as shown in the following examples: !-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds. !-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) gene, exon 4. !-Gallus gallus red-sensitive pigment mRNA, complete cds. !-Bos taurus retinal pigment (RPE1) mRNA, 3' UTR. !-Saccharomyces cerevisiae cystathionine gamma-lyase (CYS3) gene, complete cds. !-Arabidopsis thaliana pyruvate dehydrogenase E1 alpha subunit mRNA, nuclear gene for mitochondrial product, complete cds. !-Homo sapiens Down syndrome region, chromosome 13, genomic sequence. !Ophraella conferta isolate 62 16S ribosomal RNA gene, mitochondrial gene for mitochondrial product. **Example of the first line of a nucleotide FASTA sequence !>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds. **FASTA+GAP format for aligned nucleotide sequences #A number of programs output sets of aligned sequences in FASTA format. Frequently, in order to align these sequences, gaps must be inserted. In FASTA+GAP format, gaps can be indicated by a "-". Do not use the ? character to represent ambiguous bases within sequences in the alignment since Sequin removes non-IUPAC characters when it imports sequences. Each sequence, including gaps, must be the same length. The gaps will only show up in the alignment, not in the individual sequence in the database. #Sequences in FASTA+GAP format resemble FASTA sequences. The previous section on FASTA format for nucleotide sequences has instructions for formatting FASTA sequences. All sequences in FASTA+GAP format should be in the same file. #The following is an example of FASTA+GAP format: !>A-0V-1-A [org=Gallus gallus] [strain=C] !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-2-A [org=Drosophila melanogaster] [strain=D] !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-3-A [org=Caenorhabditis elegans] [strain=E] !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-4-A [org=Rattus norvegicus] [strain=F] !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !>A-0V-7-A [org=Aspergillus nidulans] [strain=G] !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT **PHYLIP format for aligned nucleotide sequences #A number of programs output sets of aligned sequences in PHYLIP format. #The following is an example of PHYLIP format. ! 5 100 !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA ! ! ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT #In this example, the first line indicates that there are 5 sequences, each with 100 nt of sequence. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence do not contain the Sequence ID. #Do not use the ? character to represent ambiguous bases within sequences in the alignment since Sequin removes non-IUPAC characters when it imports sequences. Ambiguous bases should be indicated as IUPAC characters such as N. PHYLIP files should contain - rather than ? to indicate "missing" at the 5' and 3' ends of sequences. #You can modify this format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . #Alternatively, you can leave your sequence alignment in standard PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . **NEXUS format for aligned nucleotide sequences #A number of programs output sets of aligned sequences in one of two NEXUS formats, NEXUS Interleaved and NEXUS Contiguous. #For alignment formats, such as NEXUS, do not use the ? character to represent ambiguous bases within sequences in the alignment. This is because Sequin removes non-IUPAC characters when it imports sequences. Ambiguous bases should be indicated as IUPAC characters such as N. #NEXUS files can contain ? for "missing" at the 5' and 3' ends of sequences. #The following is an example of NEXUS Interleaved format. !#NEXUS ! ![!This data assembled using Sequencher*, from Gene Codes Corporation.] !begin data; ! dimensions ntax=5 nchar=100; ! format datatype=dna gap=: interleave; ! matrix ! !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA ! ! !A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT !A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT #In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID. #The following is an example of NEXUS Contiguous format. !#NEXUS !BEGIN DATA; !DIMENSIONS NTAX=5 NCHAR=100; !FORMAT MISSING=? GAP=- DATATYPE=DNA ; !MATRIX ! !A-0V-1-A !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-2-A !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-3-A !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-4-A !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT ! !A-0V-7-A !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT #In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID. #You can modify either NEXUS format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . Alternatively, you can leave your sequence alignment in standard NEXUS format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . **Source Modifiers for PHYLIP and NEXUS #You can modify the PHYLIP or NEXUS formats so that Sequin can determine the correct organism and any other modifiers for each sequence by adding lines at the end of the file. The first line applies to the first sequence, the second line to the second sequence, and so on. You must have one line for each sequence. These inserted lines resemble the line that immediately precedes the sequence in a FASTA file except these lines should not begin with a Sequence ID. Instead, the Sequence ID is present at the beginning of the sequence lines as shown above. #Each of the initial lines starts with the character ">". The scientific organism name follows in brackets. Optional modifiers also follow in brackets. You can add individual sequence titles on these lines or you can add the same title to all sequences on the Annotation page. For further information on the data that can go in the lines preceding the sequences, see the instructions entitled "FASTA format for nucleotide sequences", above. For instructions on formatting a sequence title, see Nucleotide Definition line (title), above. #The following lines indicating the organims and strain of each sequence would follow immediately after the sequence in the PHYLIP and NEXUS examples, above. !>[org=Gallus gallus] [strain=C] !>[org=Drosophila melanogaster] [strain=D] !>[org=Caenorhabditis elegans] [strain=E] !>[org=Rattus norvegicus] [strain=F] !>[org=Aspergillus nidulans] [strain=G] #Alternatively, you can leave your sequence alignment in standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form . **Importing aligned sets of segmented sequences #Sequin can also read segmented sets which are part of an alignment if the sequences are in FASTA or FASTA+GAP format. Each segment should have its own Sequence ID, but organism name and source modifiers should only be indicated for the first segment from each sequence. Square brackets are used to delimit the members of a set. For example, ![ !>A-0V-1-Apart1 [org=Gallus gallus] [strain=C] !TCACTCTTTGGCAAC !>A-0V-1-Apart2 !GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT !] ![ !>A-0V-2-Apart1 [org=Drosophila melanogaster] [strain=D] !TCACTCTTTGGCAAC !>A-0V-2-Apart2 !GAAGCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT !] #If the sequence is in FASTA+GAP format, Sequin will keep the alignment provided. However, if the sequence is in FASTA format, you must click on the Create Alignment button in order to make Sequin generate the alignment. **To import a nucleotide sequence into Sequin #After your sequence is in the appropriate FASTA or PHYLIP format, click on "Import Nucleotide FASTA" or "Import Nucleotide PHYLIP". A new window will open showing available directories and files. Select the file containing your sequence and click OK. If you have imported the wrong sequence, select Clear under the Edit menu to remove the sequence. #After you import your sequence, a box will appear with information about the sequence. The first line will describe the number of nucleotide segments imported, and the total length in nucleotides of the sequence. Each segment is numbered, and its length, unique identifier (SeqID), and title (Definition line) are listed. If any of this information is missing, check the file containing the sequence and re-import the sequence. **To import a set of nucleotide sequences into Sequin #Sets of FASTA-formatted nucleotide sequences can be imported into Sequin in one of two ways. If all the sequences are in the same file, import the file by clicking on "Import Nucleotide FASTA." If the sequences are in separate files, import them sequentially by clicking on "Import Nucleotide FASTA." In either case, the line immediately preceding each sequence must follow the FASTA format described above. *Protein Page #Note: This page is for adding protein sequence to a single or segmented sequence. If you submitted a set of nucleotide sequences from a population, phylogenetic, or mutation study, this page will be instead called Annotation Page , and is described below. #This page allows you to provide the protein sequence translated from the nucleotide sequence which you just entered. If the nucleotide sequence is alternatively spliced or contains multiple open reading frames, enter all of the protein sequences on this page. Each protein sequence will appear in the database record as a coding sequence (CDS) feature. Sequin will automatically determine which nucleotide sequences code for the protein, and indicate the nucleotide sequence interval on the database record. Sequin also provides tools which allow you to view a graphical representation of all the open reading frames in your nucleotide sequence, and to convert these reading frames into CDS features. These tools are described later in the help documentation under the ORF Finder. **Conceptual translation confirmed by peptide sequencing #Most protein entries are computer-generated conceptual translations of a nucleic acid sequence. If you have confirmed this translation by direct sequencing either of the entire protein or of peptides derived from the protein, please check this box. **Incomplete at NH3 end/Incomplete at CO2 end #If the sequence is lacking amino acids at the amino- or carboxy-terminal end of the protein, please check the appropriate box. **FASTA def line starts with sequence ID #We suggest that for standard simple submissions you follow the instructions below for how to create a protein sequence in FASTA format. In FASTA format, the line preceding the lines of sequence consists of a ">" sign, followed by some descriptive information. If you follow the instructions, and the line immediately above your sequence reads #>SeqID [gene=locus;description] [prot=name;description] title #check this box. The unique sequence identifier for the sequence will be the word following the ">" sign. #If you have not included a SeqID, leave this box unchecked, and Sequin will assign a unique sequence identifier. However, be sure that the first line of descriptive information starts with a ">". **Create initial mRNA with CDS intervals #If you check this box, Sequin will make an mRNA feature with the same initial intervals (i.e., range of sequence) as the CDS feature. After the record has been assembled, you should edit the mRNA feature location to add the 5' UTR and 3' UTR intervals. This may be done either in the mRNA editor or in the sequence editor. **FASTA format for protein sequences #This amino acid sequence should be located in a file since you cannot directly type sequence data into this form. It must be in a certain format, called the FASTA format. If you are submitting multiple sequences, each one must be in FASTA format. Each line of sequence should be no longer than 80 characters. Remove any symbols for stop codons, such as "Z" or "*", from your sequence before importing it into Sequin. The line directly above the sequence (the first line in the file, for a single sequence) should read: #>SeqID [gene=locus;description] [prot=name;description] [comment=text] title #for example, !>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility protein] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) protein, complete sequence. #->: The ">" sign must precede any descriptive information about your sequence. Any line which does not begin with a ">" sign will be interpreted as a line of protein sequence. #-SeqID: A unique sequence identifier which you give your sequence. This field is required only if you have checked the box on the Protein page entitled "FASTA def line starts with sequence ID." This name must be different from the name which you give to other nucleotide or protein sequences. If you do not include an identifier here, Sequin will create one for you. The identifier will be changed to an accession number by the database staff later in the submission process. #-[gene=gene locus]: Enter [gene=gene locus]. Do not put spaces around the "=". The brackets are required. An example is [gene=eIF4E]. #-[prot=protein name]: Enter [prot=protein name]. Do not put spaces around the "=". The brackets are required. An example is [prot=eukaryotic initiation factor 4E-I]. #-[comment=text]: Enter [comment=text]. Do not put spaces around the "=". This field is optional. Any text that is entered will become a /note on the CDS feature (protein sequence). #-title: A definition or description of the sequence. If you do not enter a title, Sequin will create one based on information you have provided. The database staff will amend it if necessary. #The protein name should be included in the entry; all other fields are optional. **Protein Definition line (title) #Protein definition lines, or titles, follow a structured format: #Genus species Protein name (gene name) protein, complete/partial sequence. #Use the name in the format of Genus species. Choose complete or partial depending whether the sequence is complete or partial. #However, the general format does not cover all possible Definition lines, as shown in the following examples: !-Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) protein, complete sequence. !-Gallus gallus red-sensitive pigment protein, complete sequence. !-Bos taurus retinal pigment (RPE1) protein, partial sequence . !-Saccharomyces cerevisiae cystathionine gamma-lyase (CYS3) protein, complete sequence. !-Arabidopsis thaliana pyruvate dehydrogenase E1 alpha subunit protein, complete sequence, mitochondrial gene for mitochondrial protein. **Example of the first line of a protein FASTA sequence: !>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility protein] Human breast and ovarian cancer susceptibility protein (BRCA1) protein, complete sequence. **To import a protein sequence into Sequin #Click on "Import Protein FASTA." A new window will open showing available directories and files. Once a filename is selected, click OK. If you have imported the wrong sequence, select Clear under the Edit menu to remove the sequence. #After you import your sequence, a box will appear with information about the sequence. The first line will describe the number of protein sequences imported and the total length in amino acids of the sequence. Each sequence is numbered, and its length, unique identifier (SeqID), Gene name, Protein name, and title (Definition line) are listed. If any of this information is missing, check the file containing the sequence and re-import the sequence. **To import a set of protein sequences into Sequin #You may want to import a non-contiguous set of protein sequences into Sequin if, for example, you are submitting a nucleotide sequence with multiple open reading frames. Sets of protein sequences can be imported into Sequin in one of two ways. If all the sequences are in the same file, import the file by clicking on "Import Protein FASTA." If the sequences are in separate files, import them sequentially by clicking on "Import Protein FASTA." In either case, the line immediately preceding each sequence must follow the FASTA format described above. *Sequence Import Check Window #After you import protein sequence(s), a new window will appear in which you can edit information about the protein sequence. If you did not enter a unique identifier (SeqID) for the sequence, Sequin generated one automatically. The SeqID and protein name should be filled out, but the protein name can also be modified later in the submission process. Entering other information is optional. *Annotation Page #Note: This page is for adding annotations to sets of sequences from phylogenetic, population, mutation, or environmental samples set. If you submitted a single or segmented sequence, this page will be instead called Protein page , and is described above. **Adding Gene, rRNA and CDS features to a set of sequences #The radio buttons at the top of the page allow you to choose which feature(s) to add to your sequences. Any annotation you add on this page will be propagated to ALL sequences in the set, and will apply over the full length of each sequence. If you want to add annotations only to selected sequences, you must add them manually later in the submission process. You may only select one of these buttons. #-Gene: Select Gene to add a gene feature to all sequences in the set. Once you mark the radio button, additional input lines will be displayed on the form. If the gene is longer than the sequences in the submission, check Incomplete at 5' end or Incomplete at 3' end, or both. Enter the gene symbol, and a comment if necessary. #-rRNA: Select rRNA if you want to add an rRNA feature to all sequences in the set. This rRNA will span the entire sequence, from the first nucleotide to the last. Once you mark the radio button, additional input lines will be displayed on the form. If the sequence does not encode a complete rRNA molecule, check Incomplete at 5' end or Incomplete at 3' end, or both. Enter the name of the rRNA, such as 16s ribosomal RNA. The gene symbol box will be filled in automatically if you annotated a Gene feature. The comment box allows you to enter any additional comments about the rRNA. #-CDS: Select CDS if you want to add a coding sequence (amino acid translation) to all the sequences in the set. Sequin will automatically determine the CDS by selecting the longest open reading frame in the sequences. If your sequence contains multiple open reading frames, or if the desired open reading frame is not the longest, you can edit the CDS feature later in the submission process by using the Coding Region feature form. Once you mark the radio button, additional input lines will be displayed on the form. We encourage you to fill in the protein and gene locus fields. Entering information in the comment box is optional. #-None: Select none if you do not want to add a rRNA or CDS feature to all sequences in the set. **Adding a title to a set of sequences #This box allows you to add a title to each sequence in the set. Note that the identical title will be added to all sequences. You do not need to add a title here if you already included one in the FASTA format. A detailed description of the title formats preferred by the databases is provided on the Nucleotide page, above. #Titles should always start with the name of the organism. If all the sequences are from the same organism, incorporate the organism name directly into the title. However, if you are submitting sequences which derive from different organisms, for example, a phylogenetic study, do not include the organism names in the title. Instead, check the box marked "Prefix title with organism name", and Sequin will add the appropriate organism name to the title for each sequence. #Sequin will also create titles automatically, using the Generate Definition Line function under the Annotate menu. In addition, titles can be edited later in the submission process by selecting Descriptor-->Title, under the Annotate menu in the record viewer, described below. >Source Modifiers Form #You will only see this form if you are submitting sequences as part of a phylogenetic, mutation, population study, environmental samples set, or as a batch submission. #This form allows you to add or modify necessary information, such as the organism, and optional information, such as strain or chromosome, for your sequences. From the top pop-up menu, choose the modifier you want to annotate. The left column lists the sequences by their SeqID, or the unique identifier which you (or Sequin) provided for your sequence. Type the modifier for each sequence in the corresponding box labelled Value. For example, if you select the Organism modifier, you might type Mus musculus in the first Value box, Homo sapiens in the second, etc. #If you have not already supplied the scientific name of the organism, enter it on this form. Do not use abbreviations. #Complete descriptions of these modifiers can be found in the Source and Organism subpages of the Biological Source Modifiers page. You may add as many modifiers as you wish. >Editing the Record *Overview #After you finish the Organism and Sequences Form, Sequin will process your entry based on the information you have entered. The window you see now is called the record viewer. This is also the window you will see if you are submitting an update to an existing record. The instructions after this point are the same whether you are submitting a new record or an update. #In the default window of the record viewer, you will see your entry approximately as it would appear in the database. Most of the information which you entered earlier in the submission process is present in the viewer; other information, such as the contact, is still present in the record but will not be visible in the database entry. If you have provided a conceptual translation of the nucleotide sequence, the translation will be listed as a CDS Feature. Sequin automatically determines which nucleotides encode for the protein, and lists them, even if the nucleotide sequence contains introns and exons. #You can save the entry to a file by selecting Save or Save As under the File menu. This is not the same as saving the entry for submission to the database. It is a good idea to save the file at this point so that if you make any unwanted changes during the editing process you can revert to the original copy. If you wish to edit the entry later, click on "Read existing Submission" on the Welcome to Sequin form and choose the file. #It is likely that the entry could be processed now for submission to the database. However, you may wish to add information to the entry. This information may be in the form of Descriptors or Features. In general, Descriptors are annotations which apply to an entire sequence, or an entire set of sequences, and Features are annotations that apply to a specific sequence interval. For example, you may want to change the Reference Descriptor to add a published manuscript, or to annotate the sequence by adding features such as a signal peptide or poly A signal. #Information in the record viewer can be edited in different ways. One way to add or modify information is to double click within the block of information you wish to edit. Many blocks, such as "Definition," "Source," "Reference," or "Features" can be edited. For example, if you wish to add another reference for the sequence, double click on "Reference" to access the appropriate form. #A second way to add or modify information is to create a new descriptor or feature by selecting the appropriate form from the Misc or Features menus. These options are described later in this help document. #Finally, you may need to edit the sequence itself. Instructions for working with the sequence are presented in the documentation for the Sequence Editor. *Submitting the finished record to the database #Once you are satisfied that you have added all the appropriate information, you must process your entry for submission to the database. Select "Validate" under the Search menu. This function detects discrepancies between the format of your submission and that required by the database selected for entry. #If Sequin detects problems with the format of your record, you will see a screen listing the validation errors as well as suggestions for how to fix the discrepancies. Single clicking on an error message scrolls the record viewer to the feature that is causing the error. Double clicking on the error message launches a new form on which you can enter information to correct the problem. If you are annotating a set of multiple sequences, shift-click to scroll to the target sequence and feature. You can also dismiss the suggestion and proceed on your own. When you think you have corrected all the problems, click on "Revalidate." #Message: Select Verbose, Normal, or Terse. Verbose gives a more detailed explanation of the problem. #Filter: Select the error messages you wish to see. You can select ALL, SEQ_INST (errors regarding the sequence itself, its type, or length), SEQ_DESCR (descriptor errors), SEQ_FEAT (feature errors), or errors specific to your record. #Severity: Select the types of error messages you wish to see. You will see the type of message selected, as well as any messages warning of more serious problems. #There are four types of error messages, Info, Warning, Error, and Reject. Info is the least severe, and Reject is the most severe. You may submit the record even if it does contain errors. However, we encourage you to fix as many problems as possible. Note that some messages may be merely suggestions, not discrepancies. A possible Warning message is that a splice site does not match the consensus. This may be a legitimate result, but you may wish to recheck the sequence. A possible Error message is that the conceptual translation of the sequence which you supplied does not encode an open reading frame. In this case, you should check that you translated the sequence in the correct reading frame. A possible Reject message is that you neglected to include the name of the organism from which the sequence derives. The name of the organism is absolutely required for a database entry. #If Sequin does not detect any problems with the format of your record, you will see a message that "Validation test succeeded." Click the "Done" button on the submission viewer, or select "Prepare Submission" under the File menu. You will be prompted to save the file. E-mail this file to the database at the address shown. You MUST e-mail the file; Sequin does not submit the file automatically over the network. The e-mail addresses for the databases are: !-GenBank: gb-sub@ncbi.nlm.nih.gov !-EMBL: datasubs@ebi.ac.uk !-DDBJ: ddbjsub@ddbj.nig.ac.jp #After your entry is complete, close the record viewer. You will be returned to the Welcome to Sequin form, and can begin another entry. >The Record Viewer *Target Sequence #This pop-up menu shows a list of SeqIDs of all nucleotide and protein sequences associated with the Sequin entry. Use the menu to select the sequences displayed in the record viewer, as well as the sequences you want to "target," that is, the sequences you want a descriptor to apply to (see Descriptors in the Sequin help documentation). You may select either an individual sequence by name or a set of sequences, such as All Sequences, or SEG_dna if you have a segmented nucleotide set. You may change the selection at any time. *Display Format #You may change the display format of the record viewer to any of the formats described below. Editing a field in one display format will change that field in all formats. **Summary #This display format shows the entry in a graphical summary format. It is similar to the view shown in the Graphic viewer, except that lines are not labeled. The top bar represents the nucleotide sequence. Lines represent different features on the sequence, such as a CDS (coding sequence) or additional sequences if you have a set of sequences. Double click on an arrow or bar to launch an editing window. **Graphic #This display format shows the entry in a graphical view. The top bar represents the nucleotide sequence. Lower arrows or bars represent different features on the sequence. Double click on an arrow or bar to launch the appropriate editing window. Any sequence highlighted in the Sequence Editor will be boxed on the graphical view of the sequence. In order to see a graphical representation of a segmented set (see Submission type , above), the Target Sequence must be set to SEG_dna. #The Style pop-up menu allows you to see the display in different styles and colors. #The Scale pop-up menu allows you to see the display in different sizes. The smaller the number, the larger the display. **Alignment #This display format shows sets of aligned sequences, such as those imported as part of a population, phylogenetic, mutation, or environmental samples set, when the Target Sequence pop-up is set to All Sequences. Each sequence is shown as a bar. Differences between the sequences are shown as red vertical lines. To launch the viewer for an individual sequence, double click on the bar representing the sequence. To lauch the alignment editor, and see the alignment of all sequences, set the Target Sequence to All Sequences, the Display Format to Alignment, highlight the alignment by clicking on the box which surrounds the sequences, and select Edit Alignment from the Sequin Edit menu. **Sequence #This display format shows the nucleotide sequence(s) in the record along with any annotated features (such as CDS or mRNA). The display changes depending on what options are selected. Use the Sequences pop-up menu to choose the nucleotide sequences you want to display. If there are multiple sequences in the record, select Aligned to see all sequences. The entire sequence of the "master" sequence will be shown. Other sequences will appear as dots where they are identical to the master, and letters where they are different. If the multiple sequences were imported into Sequin as part of a phylogenetic, population, or mutation study, the "master" sequence can be changed by selecting different sequences in the Target Sequence pop-up. You can use the Features pop-up menu to change the display of the features. You can choose whether you want features displayed for the sequence selected in the Target Sequence pop-up, for all aligned sequences, or for no sequences. With the numbering pop-up menu, select where you want the sequence numbers to be indicated, at the side of the window, at the top of each sequence line, or not at all. **GenBank #This display format allows you to see the submission as it would appear as a GenBank or DDBJ entry. **EMBL #This display format allows you to see the submission as it would appear as an EMBL entry. **FASTA #This display shows the sequence and Definition line only, without any annotations, in a format called the FASTA format. This is a format used by many molecular biology analysis programs. You cannot edit in this display mode. **ASN.1 #This display shows the entry in Abstract Syntax Notation 1, a data description language used by the NCBI. You cannot edit in this display mode. **Desktop #The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu. *Done #This button allows you to validate the entry when you are finished with the submission. See Submitting the finished record to the database in the Sequin help documentation. *Controls on the bottom of the screen #If you have downloaded a sequence from Entrez you will see additional controls at the bottom of the screen. A sequence downloaded from Entrez will have Entrez neighboring/linking buttons. For example, by selecting the Nucleotide pop-up, you will be able to view nucleotide sequences which are similar to the sequence displayed in the Target Sequence pop-up. Similarly, select Medline to view any literature links. >Descriptors *Overview #Descriptors are annotations which apply to an entire sequence, or an entire set of sequences, in a given entry. They do not have a specific location on a sequence, as they apply to the entire sequence. They can be contrasted to Features, which apply to a specific interval of the sequence. #You may edit descriptors in one of two ways. #(1) In the record viewer, double click within the text of the descriptor to bring up a form on which information can be added. #(2) Choose the option Descriptors from the Annotate menu. *Annotate menu #This menu allows you either to create new descriptors or to modify existing ones. Select the descriptor that you wish to modify. #When you first select a descriptor, you will see a window called "Descriptor Target Control." Using the target control pop-up menu, select the sequences you wish this descriptor to cover. The name(s) listed correspond to the SeqID(s) given to the nucleotide or amino acid sequences when when they were imported into Sequin. The default selection for this menu is set in the Target Sequence pop-up menu on the record viewer. You may choose to have the descriptor cover just one sequence, or a set of sequences in your entry. If you are creating a new descriptor, select "Create New." If you wish to modify a previous descriptor, select "Edit Old." #The following is a list of some of the descriptors which can be added. Two additional descriptors, those for Publications and Biological Source, are described in other sections. **Update date #This is for database staff use only. Please do not modify the date. **Create date #This is for database staff use only. Please do not modify the date. **GenBank block #This is for database staff use only. **Region #This descriptor provides general information about the genetic context of the sequence. For example, if your nucleotide sequence is cloned from the region surrounding the Huntington's Disease gene, you could enter that information here. Providing information for this descriptor is optional. **Comment #This descriptor is used to list any additional information which you wish to provide about the sequence. Use of this descriptor is optional. **Title #This descriptor contains the information which will go on the Definition line of the database entry. If you supplied a title for your nucleotide sequence when you imported it into Sequin, that information is here. If you wish to change the Definition line, or if you did not supply a title when you submitted the sequence, edit this Descriptor. For more information on creating proper Definition lines, please see the Sequin help documentation for the Organism and Sequences Form. **Molecule description #This descriptor indicates the characteristics of the molecule from which the sequence was derived. The information which you have already entered can be edited here. ***Molecule #A GenBank sequence can represent one of several different molecule types. Enter in the Molecule pop-up menu the type of molecule that was sequenced. #-Genomic DNA: Sequence derived directly from the DNA of an organism. Note: The DNA sequence of an rRNA gene has this molecule type. #-Genomic RNA: Sequence derived directly from the genomic RNA of certain organisms, such a viruses. #-Precursor RNA: An RNA transcript before it is processed into mRNA, rRNA, tRNA, or other cellular RNA species. #-mRNA[cDNA]: A cDNA sequence derived from mRNA. #-Ribosomal RNA: A sequence derived from the RNA in ribosomes, for example, the sequence of a cDNA derived from rRNA. #-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for example, the sequence of a cDNA derived from tRNA. #-Small nuclear RNA: A sequence derived from small nuclear RNA, for example, the sequence of a cDNA derived from snRNA. #-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA, for example, the sequence of a cDNA derived from small cytoplasmic RNA. #-Peptide: Do not select this item. #-Other-Genetic [plasmid]: A sequence that is not normal genetic material but that is also is not a transcription product. Examples include plasmids, B chromosomes, and F factors. #-Genomic mRNA: Do not select this item. #-Other: Do not select this item. ***Completedness Choose the appropriate option from the pop-up menu. #-Complete: Use this designation when a complete unit, such as the complete coding sequence of a gene, is being submitted. #-Partial: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, is being submitted, and it is not known which end of the sequence is incomplete. #-No left: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted. The sequence has no left if it is incomplete on the 5', or amino-terminal, end. #-No right: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted. The sequence has no right if it is incomplete on the 3', or carboxy-terminal, end. #-No ends: Use this designation when an incomplete unit, such as the partial coding sequence of a gene, or a partial protein sequence, is being submitted, The sequence has no ends if it is incomplete at both the 5' and 3', or amino- and carboxy- terminal, ends. #-Other: Use this designation when none of the above descriptions apply. ***Technique #From the pop-up menu, select the technique that was used to generate the sequence. #-Standard: standard sequencing technique. #-EST: Expressed Sequence Tag: single-pass, low quality mRNA sequences derived from cDNAs. These sequences will appear in the EST division. #-STS: Sequence Tagged Site: an EST sequences which has been mapped onto the genome. These sequences will appear in the STS division. #-Survey: single pass genomic sequence. These sequences will appear in the Genome Survey Sequence (GSS) division. #-Genetic Map: genetic map information, for example, in the Genomes division. #-Physical Map: physical map information, for example in the Genomes division. #-Derived: A sequence assembled into a contig from shorter sequences. #-Concept-trans: a protein translation generated with the appropriate genetic code. #-Seq-pept: protein sequence was generated by direct sequencing of a peptide. #-Both: protein sequence was generated by conceptual translation and confirmed by peptide sequencing. #-Seq-pept-Overlap: protein sequence was generated by sequencing multiple peptides, and the order of peptides was determined by overlap in their sequences. #-Seq-pept-Homol: protein sequence was generated by sequencing multiple peptides, and the order of peptides was determined by homology with another protein. #-Concept-Trans-A: conceptual translation of the nucleotide sequence provided by the author of the entry. #-HTGS 0: High Throughput Genome Sequence, Phase 0. These sequences are produced by high-throughput sequencing projects, and will be in the HTG division. #-HTGS 1: High Throughput Genome Sequence, Phase 1. These sequences are produced by high-throughput sequencing projects, and will be in the HTG division. #-HTGS 2: High Throughput Genome Sequence, Phase 2. These sequences are produced by high-throughput sequencing projects, and will be in the HTG division. #-HTGS 3: High Throughput Genome Sequence, Phase 3. These sequences are produced by high-throughput sequencing projects, and will be in the HTG division. #-FLI_cDNA: Full Length Insert cDNA. Sequence corresponds to entire cDNA but not necessarily entire transcript. These sequences are produced by large sequencing projects. #-HTC: High Throughput cDNA. These sequences are produced by large sequencing projects. #-Other: use this designation when none of the above descriptions apply. ***Class: #From the pop-up menu, please select the type of molecule which was sequenced. #-DNA: DNA #-RNA: RNA #-Protein: Protein #-Nucleotide: Do not select this item. #-Other: Do not select this item. ***Topology: #From the pop-up menu, please select the topology of the sequenced molecule. #-Linear: Linear molecule (most sequences) #-Circular: Circular molecule (such as a complete plasmid) #-Tandem: Do not select this item. #-Other: Do not select this item. ***Strand: #From the pop-up menu, please select which strand of the molecule was sequenced. #-Single: Only one strand was sequenced. #-Double: Both strands were sequenced. #-Mixed: In different regions, either one or both strands were sequenced. #-Mixed Rev: Do not select this item. #-Other: Do not select this item. **Biological Source #The Biological Source descriptor is described in more detail below. >Features *Overview #Features are annotations which apply to one or more intervals on a sequence. They can be contrasted to Descriptors, which apply to an entire sequences or an entire set of sequences. Features will be added to the Target Sequence selected in the record viewer pop-up menu. Most features are indicated on the nucleotide sequence even if they refer to amino acid sequence motifs. #You may add or modify features in one of three ways. #(1) In the record viewer, double click on the text of an existing feature to bring up a form on which information can be added. #(2) Choose the feature from the Annotate menu. #(3) Choose the feature from the Sequence Editor Features menu. #The features listed in the Annotate menu and the Sequence Editor Features menu are identical, and the instructions for adding them are the same, with one exception. If you annotate them in the Annotate menu, you must provide the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you do not need to know their nucleotide coordinates. Simply highlight the sequence which the feature covers, and the location of the sequence will be automatically entered in the feature location box. *Annotate menu #This menu allows you to add or modify features on the sequence selected in the Target Sequence pop-up menu of the record viewer. Features are grouped into six categories. Select the feature which you would like to mark on your sequence. A new form will appear. #Feature forms share a common design. The first page is specific to the particular feature, e.g., Coding Region or Gene. The second page lists Properties of the Feature. The third page describes the Location of the feature. Fill out the appropriate information on the first page. **Properties Page #This page lists the properties of the feature described by the citation. ***General Subpage #Enter general comments about the feature here. #Select any of the flags if necessary. If this sequence contains only a partial representation of the feature you are describing, check the "Partial" box. Check the "Exception" box if the feature annotates a post-transcriptional modification of the nucleotide sequence, such as ribosomal slippage or RNA editing. Use the pop-up menu to select what kind of evidence supports existence of the feature. If it was confirmed experimentally, select Experimental. If you have no experimental evidence to support the feature, select Non-Experimental. If you do not wish to select either option, select the blank line. #Most features are associated with a particular gene, normally the gene from which the nucleotide sequence derives. Select the name of the gene in the pop-up menu. If you want to add the name of a new gene, select new, and enter its name and optional description. By default, mapping between the feature and the gene is done by overlap, that is, the gene associated with the feature is the gene whose location overlaps with the location of the feature. Under some circumstances, for example, if the sequences of two genes overlap, you may wish the feature to apply to a different gene. In this case, select cross-reference, and enter the name of the new gene in the pop-up menu. If you do not want the feature to map to any gene, select suppress. You may also edit information on the Gene feature form by clicking on Edit Gene Feature. ***Comment Subpage #Add any comments about the feature here, especially if you checked the "Exception" box on the General Subpage. ***Citations Subpage #This page is used to list any citations which specifically apply to the feature you are annotating. The citation must have already been entered into the record (see Publications ) in the Sequin help documentation. Click on Edit Citations, and place a check mark in box next to the publication you want to cite. In order to keep the size of the database down, we discourage the liberal use of citations on features. ***Cross-refs Subpage #This page is used to cross-reference this entry to entries in external databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as dbEST or FLYBASE. Most users should leave this page blank. For more information on this topic, see the International Nucleotide Sequence Database Collaboration page . http://www.ncbi.nlm.nih.gov/collab/db_xref.html **Location page #This page allows you to select the location of the feature you are citing. Each feature must have an sequence interval associated with it. In most cases, Sequin will know whether the feature applies to a nucleic acid or a protein sequence, and will limit the options you can select, accordingly. #Sequin is a submission tool for nucleotide sequence databases. Thus, the location for most features is indicated on the nucleotide sequence only. For example, even though mature peptide, signal peptide, and transit peptide describe protein sequence, their location is indicated on the DNA. #Check the 5' Partial or 3' Partial box if the feature in your nucleic acid sequence is missing residues at the 5' or 3' ends, respectively. Check the NH2 Partial or COO Partial if the feature in your amino acid sequence is missing residues at the amino- or carboxy-terminal ends, respectively. #Enter the sequence range of the feature. The numbers should correspond to the nucleotide sequence interval if the SeqID is set to a nucleotide sequence, and to an amino acid sequence interval if the SeqID is set to a protein sequence. If the feature spans multiple, non-continuous intervals on the sequence, indicate the beginning and end points of each interval. If each interval is separate, and should not be joined with the others to describe the feature, check the Intersperse intervals with gaps box (for example, when annotating multiple primer binding sites). If the feature is composed of several intervals which should all be joined together, do not check the box (for example, when annotating mRNA on a genomic DNA sequence). #For nucleic acid Features only: From the pop-up menu, select the strand on which the feature is found. #-Plus: Plus strand, or coding strand. #-Minus: Minus strand, or noncoding strand. #-Both: Both strands. #-Reverse: Do not select this item. #-Other: Do not select this item. #Use the pop-up menu to select the SeqID of the sequence you are describing by the location. #A brief description of the available features follows. A detailed explanation of how to use the coding region (CDS) feature is included. The DDBJ/EMBL/GenBank feature table definition page http://www.ncbi.nlm.nih.gov/collab/FT/index.html provides detailed information about other features. *attenuator #1) region of DNA at which regulation of termination of transcription occurs, which controls the expression of some bacterial operons; 2) sequence segment located between the promoter and the first structural gene that causes partial termination of transcription *C_region #Constant region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Includes one or more exons depending on the particular chain *CAAT_signal #CAAT box; part of a conserved sequence located about 75 bp upstream of the start point of eukaryotic transcription units which may be involved in RNA polymerase binding; consensus=GG(C or T)CAATCT *CDS #coding sequence; sequence of nucleotides that corresponds with the sequence of amino acids in a protein (location includes stop codon). Feature includes amino acid conceptual translation **Coding Region Page #Most users add a coding region to their sequence when they fill out the Organism and Sequences form. However, you may need to edit the coding region, or add additional ones. Choose CdRgn under the Coding Regions and Transcripts submenu of the Features menu, or, to edit an existing CDS, double click on the record viewer. If you appended the partial sequence of a coding region to the Organism and Sequences form, you will probably need to edit the Coding Region feature to avoid validation error messages about the location of the coding region. ***General Subpage #Choose the genetic code which should be used to translate the nucleotide sequence. For more information, and for the translation tables themselves, see the NCBI taxonomy page . http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c #Choose the reading frame in which to translate the sequence. #Click on Launch Product Viewer to see the record viewer for the coding region. #Supply additional information about the protein by clicking on Edit Protein Information to launch the Protein feature forms. The protein name must have already been filled out on the Protein subpage. #If retranslate on accept is checked, Sequin will, when you click on Accept, translate the nucleotide sequence according to the interval(s) indicated on the Locations page. This new translation will replace any earlier translations you have supplied. This should not be a problem if the interval was indicated appropriately. However, if you want to make sure that Sequin does not retranslate the sequence, do not check the box. #If the coding sequence which you supply is a partial sequence, and you have checked a Partial box on the Location subpage, it is a good idea to check the Synchronize Partials box. In this case, Sequin will ensure that all other appropriate features (such as protein) are also marked as partial. ***Exceptions Subpage #Exceptions describe places where there is a posttranslational modification. Enter the amino acid position at which the modification occurs, and select the amino acid which is actually represented in the protein from the pop-up list. Sequin will change the amino acid number to a nucleotide interval. ***Protein Subpage #Use this page to enter or edit a name or description of the protein product. For a new sequence, enter information directly into the boxes. You can edit descriptions of an existing sequence by clicking on Edit Protein Information, which will bring up the Protein feature form. ***Product Subpage #Choose the sequence you wish to view by selecting its name under the Product pop-up menu. You may also import a new protein sequence by selecting Import Protein FASTA under the file menu. The sequence should be formatted as described above on the Organism and Sequences form. #After you have imported a protein sequence, click on Predict Interval. This function will predict the interval on the nucleotide sequence to which the coding region applies. If you do not select this function, the interval will likely be wrong, and you will get error message when you attempt to validate the record. If your sequence is a 5' or 3' partial, you must first indicate this manually on the Locations Page. #You may also have Sequin generate the protein sequence from the nucleotide sequence by clicking on Translate Product. However, unless the location of the coding region is correctly indicated on the Location page, Sequin will translate the entire nucleotide sequence, including potential 5' and 3' untranslated regions. This will likely result in error messages when you attempt to validate the record. You must also select the correct reading frame on the General subpage. *conflict #independent determinations of the "same" sequence differ at this site or region *D-loop #displacement loop; a region within mitochondrial DNA in which a short stretch of RNA is paired with one strand of DNA, displacing the original partner DNA strand in this region; also used to describe the displacement of a region of one strand of duplex DNA by a single stranded invader in the reaction catalyzed by RecA protein *D_segment #Diversity segment of immunoglobulin heavy chain, and T-cell receptor beta chain *enhancer #a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter *exon #region of genome that codes for portion of spliced mRNA; may contain 5'UTR, all CDSs, and 3' UTR *GC_signal #GC box; a conserved GC-rich region located upstream of the start point of eukaryotic transcription units which may occur in multiple copies or in either orientation; consensus=GGGCGG *gene #region of biological interest identified as a gene and for which a name has been assigned *iDNA #intervening DNA; DNA which is eliminated through any of several kinds of recombination *intron #a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it *J_segment #Joining segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains *LTR #long terminal repeat, a sequence directly repeated at both ends of a defined sequence, of the sort typically found in retroviruses *mat_peptide #mature peptide or protein coding sequence; coding sequence for the mature or final peptide or protein product following post-translational modification. the location does not include the stop codon (unlike the corresponding CDS) *misc_binding #site in nucleic acid which covalently or non-covalently binds another moiety that cannot be described by any other Binding key (primer_bind or protein_bind) *misc_difference #feature sequence is different from that presented in the entry and cannot be described by any other Difference key (conflict, unsure, old_sequence, mutation, variation, allele, or modified_base) *misc_feature #region of biological interest which cannot be described by any other feature key *misc_recomb #site of any generalized, site-specific or replicative recombination event where there is a breakage and reunion of duplex DNA that cannot be described by other recombination keys (iDNA and virion) or qualifiers of source key (/insertion_seq, /transposon, /proviral) *misc_RNA #any transcript or RNA product that cannot be defined by other RNA keys (prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR, exon, intron, polyA_site, rRNA, tRNA, scRNA, and snRNA) *misc_signal #any region containing a signal controlling or altering gene function or expression that cannot be described by other Signal keys (promoter, CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS, polyA_signal, enhancer, attenuator, terminator, and rep_origin) *misc_structure #any secondary or tertiary structure or conformation that cannot be described by other Structure keys (stem_loop and D-loop) *modified_base #the indicated nucleotide is a modified nucleotide and should be substituted for by the indicated molecule (given in the mod_base qualifier value) *mRNA #messenger RNA; includes 5'untranslated region (5'UTR), coding sequences (CDS, exon) and 3'untranslated region (3'UTR) *N_region #Extra nucleotides inserted between rearranged immunoglobulin segments *old_sequence #the presented sequence revises a previous version of the sequence at this location *polyA_signal #recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by polyadenylation; consensus=AATAAA *polyA_site #site on an RNA transcript to which will be added adenine residues by post-transcriptional polyadenylation *precursor_RNA #any RNA species that is not yet the mature RNA product; may include 5' clipped region (5'clip), 5' untranslated region (5'UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3'UTR), and 3' clipped region (3'clip) *prim_transcript #primary (initial, unprocessed) transcript; includes 5' clipped region (5'clip), 5' untranslated region (5'UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3'UTR), and 3' clipped region (3'clip) *primer_bind #Non-covalent primer binding site for initiation of replication, transcription, or reverse transcription. Includes site(s) for synthetic e.g., PCR primer elements *promoter #region on a DNA molecule involved in RNA polymerase binding to initiate transcription *protein_bind #non-covalent protein binding site on nucleic acid *RBS #ribosome binding site *repeat_region #region of genome containing repeating units *repeat_unit #single repeat element *rep_origin #origin of replication; starting site for duplication of nucleic acid to give two identical copies *rRNA #mature ribosomal RNA ; the RNA component of the ribonucleoprotein particle (ribosome) which assembles amino acids into proteins *S_region #Switch region of immunoglobulin heavy chains. Involved in the rearrangement of heavy chain DNA leading to the expression of a different immunoglobulin class from the same B-cell *satellite #many tandem repeats (identical or related) of a short basic repeating unit; many have a base composition or other property different from the genome average that allows them to be separated from the bulk (main band) genomic DNA *scRNA #small cytoplasmic RNA; any one of several small cytoplasmic RNA molecules present in the cytoplasm and (sometimes) nucleus of a eukaryote *sig_peptide #signal peptide coding sequence; coding sequence for an N-terminal domain of a secreted protein; this domain is involved in attaching nascent polypeptide to the membrane; leader sequence *snRNA #small nuclear RNA; any one of many small RNA species confined to the nucleus; several of the snRNAs are involved in splicing or other RNA processing reactions *source #identifies the biological source of the specified span of the sequence. This key is mandatory. Every entry will have, as a minimum, a single source key spanning the entire sequence. More than one source key per sequence is permittable *stem_loop #hairpin; a double-helical region formed by base-pairing between adjacent (inverted) complementary sequences in a single strand of RNA or DNA *STS #Sequence Tagged Site. Short, single-copy DNA sequence that characterizes a mapping landmark on the genome and can be detected by PCR. A region of the genome can be mapped by determining the order of a series of STSs *TATA_signal #TATA box; Goldberg-Hogness box; a conserved AT-rich septamer found about 25 bp before the start point of each eukaryotic RNA polymerase II transcript unit which may be involved in positioning the enzyme for correct initiation; consensus=TATA(A or T)A(A or T) *terminator #sequence of DNA located either at the end of the transcript or adjacent to a promoter region that causes RNA polymerase to terminate transcription; may also be site of binding of repressor protein *transit_peptide #transit peptide coding sequence; coding sequence for an N-terminal domain of a nuclear-encoded organellar protein; this domain is involved in post- translational import of the protein into the organelle *tRNA #mature transfer RNA, a small RNA molecule (75-85 bases long) that mediates the translation of a nucleic acid sequence into an amino acid sequence *unsure #author is unsure of exact sequence in this region *V_region #Variable region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for the variable amino terminal portion. Can be made up from V_segments, D_segments, N_regions, and J_segments *V_segment #Variable segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for most of the variable region (V_region) and the last few amino acids of the leader peptide *variation #a related strain contains stable mutations from the same gene (e.g., RFLPs, polymorphisms, etc.) which differ from the presented sequence at this location (and possibly others) *3'clip #3'-most region of a precursor transcript that is clipped off during processing *3'UTR #region near or at the 3' end of a mature transcript (usually following the stop codon) that is not translated into a protein; trailer *5'clip #5'-most region of a precursor transcript that is clipped off during processing *5'UTR #region near or at the 5' end of a mature transcript (usually preceding the initiation codon) that is not translated into a protein; leader * -10_signal #Pribnow box; a conserved region about 10 bp upstream of the start point of bacterial transcription units which may be involved in binding RNA polymerase; consensus=TAtAaT * -35_signal #a conserved hexamer about 35 bp upstream of the start point of bacterial transcription units; consensus = TTGACa or TGTTGACA >Biological Source #This annotation is very important, as an entry cannot be processed by the databases unless it includes some basic information about the organism from which the sequence derived. This basic information was entered previously in the submission, in the Organism and Sequences Form. The more detailed Organism Information form allows you to alter or add to the data you entered earlier. *Overview: Descriptor or Feature? #Sequin allows two types of biological source information to be entered, Biological Source Descriptors and Biological Source Features. Biological Source Descriptors, like other descriptors, provide organism information about an entire sequence, or an entire set of sequences, in an entry. Biological Source Features, like other features, provide organism information about a specific interval on a given sequence. #In most cases, you will want to use a Biological Source Descriptor, as all the sequences in the entry will derive from the same source. However, if you have sequenced a chimeric molecule, for example, one that is part yeast and part mouse, you would use Biological Source Features to annotate which sequence derived from yeast and which from mouse. #To add a Biological Source Descriptor, select Biological Source under the Descriptor section of the Annotate menu. To add a Biological Source Feature, select Biological Source under the Bibliographic and Comments section of the Annotate menu. #Annotating a Biological Source Descriptor or Feature is similar to annotating any descriptor or feature. For help in creating descriptors and features, see the appropriate section of the help documentation. The following are instructions for filling out Biological Source-specific forms. *Organism Page. **Names Subpage #The scrollable list contains the scientific names of many organisms. To reach a name on the list, either type the first few letters of the scientific name, or use the thumb bar. Click on a name from the list to fill out the scientific name field. If there is a common name for the organism, that field will be filled out automatically. You may also directly type in the scientific name. If you have any questions about the scientific or common name of an organism, see the NCBI taxonomy browser http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html **Location Subpage ***Location of Sequence #From the selection list, please enter the location of the genome which contains your sequence. Most entries will have a "Genomic" location. A brief description of the choices in this pop-up menu were listed previously. ***Origin of Sequence #This menu is for the use of database personnel. Please leave this field empty. **Genetic Codes Subpage ***Nuclear #Please use this field to select the genetic code which should be used to translate the nucleic acid sequence. The genetic code for a eukaryotic organism is "Standard". If you selected an organism name from the scrollable list described above, this field was filled out automatically. #For more information regarding the translation tables available, see the NCBI taxonomy page . http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c ***Mitochondrial #-Do not select this item. **Lineage Subpage #This information is normally entered by the database staff. They will use the taxonomy database http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html maintained by the NCBI/GenBank. If you wish to enter a taxonomic lineage which is different than that in the NCBI database, please enter it here. #If you are running Sequin in its network-aware mode, you will see a button labelled "Lookup Taxonomy." Click on this button to perform an automatic lookup of the taxonomic lineage of the organism. Sequin will perform the lookup by accessing the Taxonomy database at the NCBI, and will fill out the Taxonomic Lineage and Division fields. #If you have any comments about the taxonomic lineage determined by Sequin, please submit these comments with your entry. Under the Sequin File menu, select Edit Submitter Info. Enter your comments in the box entitled "Special Instructions to Database Staff", on the Submission page. Someone from the NCBI will contact you after your submission is received. *Modifiers Page #This page allows you to enter additional information about the source and/or organism. Entering information is optional. **Source Subpage #Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional source information as text in the field at the bottom of the page. You may select as many modifiers as you want. #The following is a description of the available modifiers: #-Chromosome: Chromosome to which the gene maps. #-Map: Map location of the gene. #-Clone: Name of clone from which sequence was obtained. #-Subclone: Name of subclone from which sequence was obtained. #-Haplotype: Haplotype of the organism. #-Genotype: Genotype of the organism. #-Sex: Sex of the organism from which the sequence derives. #-Cell-line: Cell line from which sequence derives. #-Cell-type: Type of cell from which sequence derives. #-Tissue-type: Type of tissue from which sequence derives. #-Clone-lib: Name of library from which sequence was obtained. #-Dev-stage: Developmental stage of organism. #-Frequency: Frequency of occurrence of a feature. #-Germline: If the sequence shown is DNA and a member of the immunoglobulin family, this qualifier is used to denote that the sequence is from unrearranged DNA. #-Rearranged: If the sequence shown is DNA and a member of the immunoglobulin family, this qualifier is used to denote that the sequence is from rearranged DNA. #-Lab-host: Laboratory host used to propagate the organism from which the sequence was derived. #-Pop-variant: Name of the population variant from which the sequence was obtained. #-Tissue-lib: Tissue library from which the sequence was obtained. #-Plasmid-name: Name of plasmid from which the sequence was obtained. #-Transposon-name: Name of transposable element from which the sequence was obtained. #-Ins-sequence-name: Name of insertion element from which the sequence was obtained. #-Plastid-name: Name of plastid from which the sequence was obtained. #-Country: The country of origin of DNA samples used for epidemiological or population studies. #-Segment: Name of viral genome fragmented into two or more nucleic acid molecules. #-Endogenous-virus-name: Name of inactive virus that is integrated into the chromosome of its host cell and can therefore exhibit vertical transmission. **Organism Subpage #Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional organism information as text in the field at the bottom of the page. You may select as many modifiers as you want. #The following is a description of the available modifiers: #-Strain: Strain of organism from which sequence was obtained. #-Substrain: Sub-strain of organism from which sequence was obtained. #-Type: Type of organism from which sequence was obtained. #-Subtype: Subtype of organism from which sequence was obtained. #-Variety: Variety of organism from which sequence was obtained. #-Serotype: Variety of a species (usually a fungus, bacteria or virus) characterized by its antigenic properties. Same as serogroup and serovar. #-Serogroup: See serotype. #-Serovar: See serotype. #-Cultivar: Cultivated variety of plant from which sequence was obtained. #-Pathovar: Variety of a species (usually a fungus, bacteria or virus) characterized by the biological target of the pathogen. Examples include Pseudomonas syringae pathovar tomato and Pseudomonas syringae pathovar tabaci. #-Chemovar: Variety of a species (usually a fungus, bacteria or virus) characterized by its biochemical properties. #-Biovar: Variety of a species (usually a fungus, bacteria or virus) characterized by some specific biological property (often geographical, ecological, or physiological). Same as biotype. #-Biotype: See biovar. #-Group: Do not select this item. #-Subgroup: Do not select this item. #-Isolate: Identification or description of the specific individual from which this sequence was obtained. An example is Patient X14. #-Common: Common name of the organism from which sequence was obtained. #-Acronym: Standard synonym (usually of a virus) based on the initials of the formal name. An example is HIV-1. #-Dosage: Do not select this item. #-Natural Host: When the sequence submission is from an organism that exists in a symbiotic, parasitic or other special relationship with some second organism, the 'natural host' modifier can be used to identify the name of the host species. #-Sub-species: Subspecies of organism from which sequence was obtained. #-Specimen-voucher: An identifier of the individual or collection of the source organism and the place where it is currently stored, usually an institution. #-Authority: The author or authors of the organism name from which sequence was obtained. #-Forma: The forma (lowest taxonomic unit governed by the nomenclatural codes) of organism from which sequence was obtained. This term is usually applied to plants and fungi. #-Forma-specialis: The physiologically distinct form from which sequence was obtained (usually restricted to certain parasitic fungi). #-Ecotype: The named ecotype (population adapted to a local habitat) from which sequence was obtained (customarily applied to populations of Arabidopsis thaliana). #-Synonym: The synonym (alternate scientific name) of the organism name from which sequence was obtained. #-Anamorph: The scientific name applied to the asexual phase of a fungus. #-Teleomorph: The scientific name applied to the sexual phase of a fungus. #-Breed: The named breed from which sequence was obtained (usually applied to domesticated mammals). #-Old name: Do not select this item. *Miscellaneous Page **Synonyms Subpage #If there are alternative names for the organism from which the sequence derives, enter them here. Please be aware that this is the appropriate field only for alternative names for the organism, not for alternative gene or protein names. **Cross-refs Subpage #This page is used to cross-reference this entry to entries in external databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as dbEST or FLYBASE. Most users should leave this page blank. For more information on this topic, see the International Nucleotide Sequence Database Collaboration page . http://www.ncbi.nlm.nih.gov/collab/db_xref.html >Publications *Overview: Descriptor or Feature? #Sequin allows two types of publications to be entered, Publication Descriptors and Publication Features. Publication Descriptors are bibliographic references which, like other descriptors, cover an entire sequence, or an entire set of sequences, in an entry. Publication Features are bibliographic references which, like other features, cover a specific interval on a given sequence. #Publications are entered into the Reference field of the database entry. References are citations of unpublished, in press, or published works which are relevant to the submitted sequence. You may add as many citations as you wish. However, you must decide whether the Publication should be entered as a descriptor or a feature. #In general, if there is one publication describing a sequence, a Publication Descriptor should be used. If multiple publications all describe the same sequence, only the reference which appeared first in print should be included in the descriptor. To enter a Publication Decriptor, select Publications under the Annotate menu, and click on Publication Descriptor. #However, if one publication describes the cloning of the 5' end of a gene, and another publication describes the cloning of the 3' end of the gene, Publication features should be used. To make a publication feature, first, enter the publication itself into the record by choosing Publication Feature in the Publications section of the Annotate menu. Enter the information about the publication, and then enter the interval (on the Location page) that the publication refers to. Next, add this reference to the feature by double clicking on the feature, going to the Citations subpage of the Properties page, clicking on Edit Citations, and selecting the citation(s) you want to add. #We do not encourage the liberal use of Publication Features in an entry in an effort to keep the size of the database down. Please enter a reference for a feature only if it is a novel or controversial feature. #If you plan to add a reference to a published journal article, you should run Sequin in its network-aware mode. In this mode, the program, if supplied with certain minimal information, automatically fills out the Title, Authors, and Journal pages by looking up the information in the Medline database. Instructions for making Sequin network aware are provided in the documentation for the Misc menu. Instructions for performing a Medline lookup are provided below. #Annotating a Publication Descriptor or a Publication Feature is similar to annotating any descriptor or feature. For help in creating descriptors and features, see the appropriate section of the help documentation. The following are instructions for filling out Publication-specific forms. *Citation on Entry Form **Status #Using the radio buttons, select one of the three options: #-Unpublished: Select this option if (1) There are no plans to publish a manuscript describing this sequence submission, (2) A manuscript has been written but not yet submitted, or, (3) A manuscript has been submitted for publication but has not yet been accepted. #-In Press: The article has been accepted for publication but is not yet in print. #-Published: The article has been published. **Class #Using the radio buttons, select the type of publication in which the sequence will appear. #-Journal: Journal #-Book Chapter: Chapter in a book #-Book: Entire book #-Thesis/Monograph: Thesis or monograph #-Proceedings Chapter: Abstract from a meeting #-Proceedings: A meeting #-Patent: Patent #-Submission: **Scope Please select one or more option using the radio buttons: #-Refers to the entire sequence: The publication listed in this citation describes the entire sequence in this entry. This is most commonly the publication in which the sequence is first described. #-Refers to part of the sequence: The publication listed in this citation describes only a part of the sequence. This option should be used when (1) Different parts of a sequence have been generated by different investigators, or (2) The sequence was generated in segments over a period of time. #-Cites a feature on the sequence: The publication listed in this citation describes or refers to a feature (such as a class of promoter or a motif) which has been found in the sequence. #After you have filled out the Citation on Entry form, click on "Proceed" to see the next form. *Citation Information Form (General) #At the bottom of each page are two options: Accept and Cancel. Click on "Accept" to replace all parts of an existing citation with the information entered on this form. Click "Cancel" to cancel the process of changing a citation. **Authors Page ***Names Subpage #Please enter the names of the authors. Note that the first name of the author is listed first. You can add as many authors to this page as you wish. After you type in the name of the third author, the box becomes a spreadsheet, and you can scroll down to the next line by using the thumb bar. ***Affiliation Subpage #Please enter information about the institution with which the principal author of the manuscript is affiliated. #Other pages in the Citation Information Form will be different depending on the Class of publication selected in the Citation on Entry Form. Instructions for filling out the Citation Information Form for Journals is included here. *Citation Information Form (If selected Class was Journal) **Title Page #Enter title for manuscript in the box. **Journal Page #Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year fields by typing information into the boxes. Select the month with the pop-up menu. If necessary, choose an option from the Erratum pop-up menu and explain the erratum. If you know the MUID, the Medline Unique Identifier, please enter it. #If you are running Sequin in its network-aware mode, the program will look up the Title, Author, and Journal information in the Medline database if you supply it with some minimal information. For example, if you know the MUID (Medline Unique Identifier) of the publication, enter it in the appropriate box and select "Lookup By MUID." Sequin will automatically retrieve the rest of the information. One way to find the MUID of the publication is to look up the publication with the NCBI's Entrez service. Alternatively, if you do not know the MUID, enter the Journal, Volume, Pages, and Year. Then select "Lookup Article." Sequin will retrieve the missing Title and Authors inforamtion. **Remark Page #This can be any additional comment that should be associated with this citation. >File Menu *About Sequin #Details about the current version of Sequin. *Help #Launches the help documentation. *Open #Open an existing entry. This option will open a record which has been previously saved in Sequin. Furthermore, for analysis purposes, it can also open a FASTA-formatted sequence file. The sequence will be displayed in Sequin and can be analyzed with tools such as CDD BLAST, but it should not be submitted, because it does not have the appropriate annotations. *FASTA Nucleotide Direct to Sequence Editor #Opens a FASTA formatted sequence directly into the Sequence Editor. The sequence can then be analyzed with tools such as the "Find" command. *Close #Close this entry. *Export GenBank #Exports the GenBank flatfile format to a file. *Duplicate View #Duplicates the entry. You can then view the entry simultaneously in different Display Formats. *Save #Saves the entry. Note: This merely saves the entry so you can go back and edit it. It does not prepare the entry for submission to the database, that is, it does not validate the entry. *Save As #See Save. *Restore #Replaces the displayed record with previously saved version. This feature is useful if you have made unwanted changes since you last saved the record. *Prepare Submission #Prepares the entry for submission to the database. See Submitting the finished record to the database in the Sequin help documentation. *Print #Prints the window which is currently selected. The selected window can be one of the Sequin forms or pages, or the help documentation. *Quit #Exit from Sequin. >Edit Menu *Copy #Copy the selected item. *Clear #Clear the selected item. *Duplicate #Duplicates the selected feature. *Edit sequence #To edit a single sequence, select the sequence identifier in the Target Sequence pop-up menu, and click on Edit sequence. The sequence editor will be launched for that sequence. The sequence editor is discussed in more detail below. *Edit alignment #To edit a set of aligned sequences, select All Sequences in the Target Sequence pop-up menu and select Alignment in the Display Format. Highlight the alignment by clicking inside of the box surrounding the sequence bars, and click on Edit alignment. The alignment editor will be launched. The alignment editor is discussed in more detail below. *Edit Submitter Info #Opens up the Submission Instructions form, which allows you to enter additional information about the person submitting the record. Much of this information was entered on the first form in Sequin, the Submitting Authors form. #You can also save the information from the Submitting Authors form here, so that you can use it in subsequent Sequin submissions. Click on "Edit Submitter Info", and, under the file menu in the resulting Submission Instructions form, click on Export Submitter Info to save the information to a file. For subsequent Sequin submissions, if you have already saved the submittor information, click on Import Submitter Info under the File menu on the Submission page of the Submitting Authors form. **Submission page #Indicate the type of submission. If it is a new submission, select New. If you are updating an existing submission in order to resubmit it to the databases, select Update. Check either the "Yes" or "No" radio button to indicate if the record should be released before publication. If you select "Yes," the entry will be released to the public after the database staff has added it to the database. If you select "No," fields will appear in which you can indicate the date on which the sequences should be released to the public. The submission will then be held back by the database staff until formal publication of the sequence or GenBank Accession Number, or until the Release Date, whichever comes first. If you have any special instructions, enter them in the box at the bottom of the page. **Contact page #Update the name, affiliation, or contact numbers of the person submitting the record. **Citation page #Update the names and affiliation of the people who should receive scientific credit for the generation of sequences in this entry. The address should list the principal institution in which the sequencing and/or analysis was carried out. If multiple labs were involved in the project, this page should contain information about the workplace of the senior author. If you are submitting the record as an update to the databases, explain the reason for the update on the Description subpage. *Update Sequence #This selection allows you to replace a sequence with another sequence, merge two sequences which overlap at their ends, 'patch' a corrected fragment of a sequence to the current sequence, or copy features from one sequence to another. #Use Read FASTA file to import a sequence in FASTA format. Use Read Sequence Record to import a sequence in ASN.1 format (for example, a sequence record which has already been saved in Sequin). If you are running Sequin in Network Aware mode, you can use Download Accession to import a record from Entrez. If you have done a QBLAST search, you can use Selected Alignment to import a sequence from the alignment that you have selected in the Graphic or Alignment view. #In all cases, the imported and original sequences must have regions similar enough for the two sequences to be aligned. If the sequences are not similar enough to generate an alignment, Sequin will inform you that the similarity is insufficient to perform the update. #After you import the updated sequence, a new window will open which displays two graphical views and the text of the alignment of the new and old sequence. The first graphic displays the relative length of the two sequences and the length of the overlapping region between sequences. The second graphic represents any inserts, deletions, or point changes within the aligned region between the new and old sequences. Clicking on a region in this graphic will scroll to the corresponding nucleotide sequence in the alignment text below. #The alignment relationship box shows the action that will be performed upon updating the sequence: i.e., replace, extend 5', extend 3', or patch. The patch function allows you to replace an internal fragment of the sequence without affecting flanking regions. #When updating via the Download Accession or Read Sequence Record methods, the update operation box allows you to specify whether the sequence and/or the features should be updated. In cases where the new and old records contain duplicate features, you may chose to retain the new and/or old feature or merge the duplicated features into one. *Feature Propagate #This selection allows you to propagate any annotated feature from one sequence in an aligned set to other sequences within the set. For example, if one nucleotide sequence in the alignment contains a CDS feature, you can annotate a similar CDS, over the same interval, to the other nucleotide sequences in the set. #The default source of features to be propagated is the first member of the set. If you wish to use a different entry as the source of the features, scope to that entry in the Target Sequence menu before selecting Feature Propagate from the Edit menu. #The Feature Propagate window allows you to select which features will be propagated and whether the features will be extended or split at gaps in the alignment. The split at gaps selection will produce two features, one on either side of the gap within the alignment. If you are propagating a CDS feature, you may specify that the translation end or extend through internal stop codons. You may also extend the translation after the stop codon on the source entry by chosing to translate the CDS after partial 3' boundary. *Add Sequence #This selection allows you to add a new sequence to an existing population, mutation, phylogenetic, or environmental sample set. You may import the new entry in FASTA format or ASN.1 format (for example, a sequence record which has been saved in Sequin). >Search menu *Find ASN.1 #Under this command, you can find and replace strings of letters in those fields of your submission that contain manually entered data. The fields which can be altered are Locus, Definition, Accession, Keywords, Source, Reference and Features. To use this option, select Find and fill the Find and Replace lines with the appropriate text. Note that you cannot edit the sequence in this way. *Find FlatFile #Under this command, you can find strings of letters in all fields of your submission. *Validate #This option detects discrepancies between the format of your submission and that required by the database selected for entry. If discrepancies are present, it suggests ways in which to correct them. See the topic on Submitting the finished record to the database in the Sequin help documentation. *Spell Check #Performs a spelling check on the record. *CDD BLAST #Performs a CDD BLAST search of the selected sequence against the NCBI's Conserved Domain Database . In order to do a CDD BLAST search, Sequin must be in its network aware mode. #CDD currently contains domains derived from two popular collections, Smart and Pfam, plus contributions from colleagues at NCBI. The source databases also provide descriptions and links to citations. Since conserved domains correspond to compact structural units, CDs contain links to 3D-structure via Cn3D whenever possible #The results of the CDD search will be displayed in the record viewer. These results are for your use only and should be removed from the record before submission. *ORF Finder #The ORF Finder shows a graphical representation of all the open reading frames (ORFs) in the nucleotide sequence. This tool allows you to select ORFs and have them appear as coding sequence (CDS) features on the sequence record. #The ORFs, indicated by colored boxes, are defined as the longest sequence which stretches from a start codon to a stop codon. If the entire nucleotide sequence is an open reading frame, but does not contain an initial start or a terminal stop codon, it will be indicated as an ORF as well. All six reading frames are shown; the top three boxes represent the plus strands, and the bottom three boxes the minus strands. The nucleotide sequence intervals of the ORFs are displayed in descending length order on the right side of the window. Intervals on the complementary (minus) strand are indicated by a c. ORFs can be selected by clicking either directly on them or on the sequence interval. The ORF length button selects the length of ORFs which are displayed. For example, the default of 10 shows all ORFs which are greater than 10 nucleotides in length. Clicking on the box labelled ORF changes the display; potential start codons are indicated in white, and stop codons in red. ORFs can be selected in this display also. The definition of start and stop codons is dependent on the genetic code which was selected. Be sure to choose the appropriate genetic code from translating the sequence before opening the ORF finder. #The ORF finder works in conjunction with the Sequence Editor. Once an ORF is selected, its sequence is highlighted in the editor. Using tools in the Sequence Editor, you can make the highlighted sequence into a CDS, translate it, and save it as a CDS feature in the record. See the documentation on Editing a CDS in the Sequence editor . *Select Target #This option changes the sequence which is selected in the Target Sequence pop-up. Type the SeqID of the sequence in the box, and the record viewer will be updated to display that sequence. >Misc Menu *Style Manager #The Style manager allows you to choose between different formats in which to view the Graphical Display Format. The graphical display is selected by choosing the Graphic display format on the record viewer. Using the Style Manager, you can also copy the style or modify it to suit your needs. *Net Configure #As a default, Sequin is available as a stand-alone program. However, the program can also be configured to exchange information with the NCBI (GenBank) over the Internet. The network-aware mode of Sequin is identical to the stand-alone mode, but it contains some additional useful options. #Sequin will only function in its network-aware mode if the computer on which it resides has a direct Internet connection. Electronic mail access to the Internet is insufficient. In general, if you can install and use a WWW-browser on your system, you should be able to install and use network-aware Sequin. Check with your system administrator or Internet provider if you are uncertain as to whether you have direct Internet connectivity. #There are two ways to change Sequin into its network aware mode. If you are still on the initial Welcome to Sequin form, select Net Configure under the Misc menu. If you have already worked on a Sequin submission, and are looking at the record in the record viewer, select the Net Configure option from the Misc menu. #Most users will be able to use the default (Normal) settings on the Network Configuration page; select Accept to complete the configuration process. #If a "Normal" Connection does not work, you may need to select the Firewall Connection. Contact your system administrator to determine what to enter into the Proxy and Port fields. If you do not have access to domain name server (DNS), uncheck this box. #The Timeout pop-up selects the length of time which your local copy of Sequin will wait for a reply from the NCBI server. You may need to set this number higher (i.e., 60 seconds or 5 minutes) if you are outside of the United States or have a bad internet connection. #If you have problems setting up the network configuration, contact info@ncbi.nlm.nih.gov #If you wish to change Sequin back to its stand-alone mode, select Net Configure again from the Misc menu. Click on Connection: None. #The network-aware mode of Sequin allows you to perform a number of additional, important functions. These functions all appear as additional menu items. A brief description of these functions follows. Further descriptions are available as indicated elsewhere in the help documentation. **Updating existing GenBank records: #Using Sequin in its network-aware mode, you can download an existing GenBank record from Entrez using the GenBank accession number or GI identification number (NID). You can then use Sequin to make any necessary changes to the record, and resubmit it to GenBank as a sequence update. Instructions for submitting sequence updates are presented under the Welcome to Sequin Form. You can download any record from Entrez and look at it in Sequin. However, you can only perform a formal database update only those records which you have previously submitted yourself. **Performing a Medline lookup: #In its network-aware mode, Sequin can import the relevant sections of a Medline record directly into a sequence submission record. Rather than typing in the entire citation, you can enter minimal information, such as the Medline Unique Identifier (MUID), or Journal name, volume, year, and pages. The Medline lookup is explained in the section of the documentation entitled Publications. **Performing a Taxonomy lookup: #In its network-aware mode, Sequin can look up the taxonomic lineage of an organism from the NCBI's taxonomy database. This lookup is normally performed by the NCBI database staff after the record has been submitted to GenBank. If you look up the taxonomy before submitting the sequence, you can make a note in the record of any disagreements. The taxonomy lookup is explained in the in the section of the documentation covering Biological Source: Organism page: Lineage subpage. **Accessing the NCBI DeskTop: #The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu. *Entrez Query #This option allows you to perform a query against the NCBI's Entrez database. http://www.ncbi.nlm.nih.gov/Entrez #If you have downloaded a sequence from Entrez, it will have the Entrez neighbor buttons at the bottom of the window. To see similar nucleotide sequences, select Nucleotide in the Target pop-up menu, and then click on the Neighbor button to the left to get the Entrez list of related sequences. To see the Entrez records for any publications or CDSs in the record, select the Medline or Protein database, and click on the Lookup button. Any associated Genome or Structure records can also be viewed. *NCBI DeskTop #This option is only available if you are running Sequin in its network-aware mode. #The NCBI DeskTop provides a view of the internal structure of the Sequin record, the ASN.1. Its display resembles a Venn diagram, and represents all the structures represented in the ASN.1 data model. #In addition, a number of undocumented software tools from the NCBI can be accessed from the DeskTop. These tools are components of the NCBI portable software toolkit. You can also customize these functions using the toolkit with your own software tools. The toolkit and its documentation are available from the NCBI by anonymous FTP. #The DeskTop should only be used by very seasoned users. At this time, we are not providing any documentation for these specialized functions. >Annotate Menu #This menu allows you to enter features and descriptors on the sequence. #The first six options, Genes and Named Regions, Coding Regions and Transcripts, Structural RNAs, Bibliographic and Comments, Sites and Bonds, and Remaining Features refer to types of Features that can be added to the sequence. Features are described in more detail in the above section entitled Features. #The seventh option, Publications, allows you to add a Publication Feature or Publication Descriptor to the record. Publications are described in more detail in the above section entitiled Publications. #The eighth option, Descriptors, allows you to add Descriptors to the record. Descriptors are described in more detail in the section entitled Descriptors, above. #The ninth option Generate Definition Line, will generate an title for your sequence based on the information provided in the record. This option will work for single sequences as well as sets of sequences, and can handle complex annotations with multiple features. The title will follow GenBank conventions, but may be modified by the database staff if it is not appropriate. The title you enter here will replace any title you entered elsewhere in the submission, for example, any title which was attached to the nucleotide sequence. For a description of definition lines, see Nucleotide Definition line (title) , above. >Options Menu *Font #Use this item to change the display font. From the pop-up menus, choose the style and size of type. For additional changes, mark the Bold, Italic, or Underline check boxes. The default font is 10 point courier. *Legend #Enabled only in the Graphic view, it shows what the various kinds of features used in the picture look like, i.e., what colors and styles and fonts each one uses. >Sequence Editor #This editor allows you to modify the nucleotide or amino acid sequences in your entry. For example, you can add or remove nucleotides, or you can add or remove CDS (coding sequence) features from the entry. #Even though the Sequence Editor does allow you to undo changes you make to the sequence, we strongly suggest that you save a copy of the entry before launching the Sequence Editor so that you can revert to it if necessary. *Starting the Sequence Editor #The sequence which appears in the editor is dependent on the sequence(s) selected in the Target Sequence pop-up menu. There are two ways to launch the sequence editor for nucleotide sequences. First, you can double click within sequence in any display format of the record viewer. A window containing the DNA sequence will appear. Second, in the record viewer, select the sequence you wish to edit in the Target Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You can launch the editor for protein sequences in two ways also. If you select the protein sequence in the Target Sequence pop-up menu, double click within the protein sequence. A window containing the protein sequence will appear. If you select a nucleotide sequence in the Target Sequence pop-up menu, double click within the CDS (coding sequence) feature to launch the Coding Region feature form (see Features in the Sequin help documentation). Click on "Launch Product Viewer" to start the sequence editor. Both methods of accessing the protein sequence editor will result in the same display window. *Moving around the Sequence Editor #The cursor can be moved with the mouse or the arrow keys. The display window will change to show the position of the cursor. The sequence location of the first residue on each line is indicated on the left side of the window. The cursor location, or the range of sequences selected by the mouse, is shown in the upper left corner of the window. If you want to move the cursor to a specific location, type the number in the box on the top left of the sequence editor window, and hit the Go to button. If you want to look at a specific sequence, but not move the cursor to it, type the number in the upper right box of the window and hit the Look at button. *Editing sequence #Select a piece of sequence by highlighting it with the mouse. To select the entire sequence, click on a sequence location number on the left side of the window. Any sequence that is highlighted in the Sequence Editor will show up as a box on the sequence when it is viewed in the Graphic Display Format. #One way to insert and delete residues is with the mouse. Move the cursor to the appropriate location and type. Text will be inserted to the left of the cursor. Delete sequence with the backspace or delete key. Text will be deleted to the left of the cursor. To delete a block of sequence, highlight it with the mouse and use the delete or backspace key. #Another way to insert and delete residues is with options under the Edit menu of the Sequence Editor. Use Cut to remove, or Copy to copy, highlighted residues. Paste these sequences anywhere. Use Clear to permanently remove highlighted residues. #To save changes you have made to the sequence, press the Accept button at the bottom of the Sequence Editor display window. If you do not wish to save the changes, press the Cancel button at the bottom of the Sequence Editor display window. Selecting either Accept or Cancel will quit the Sequence Editor and return you to the record viewer. Please note that any changes you make will not become a permanent part of the Sequin record until you Save the record in the record viewer. The Save button at the bottom of the Sequence Editor display window is used only to save a CDS feature. *Changing the display #The default sequence displayed for a nucleotide sequence is the coding strand. If you wish to see the complement of this sequence, that is, if you wish to see the double stranded version of this sequence, select Complement under the Sequence Editor View menu. You can also elect to see the translation of the top stand. Select Reading Frames + under the Sequence Editor View menu to see the three phase translation of the upper (coding) nucleotide strand. Select Reading Frames - under the Sequence Editor View menu to see the three phase translation of the lower (noncoding) nucleotide strand. Methionine residues are colored. Complement, Reading Frames +, and Reading Frames - can be selected simultaneously or individually. #Only the top nucleotide strand can be edited. Any changes made in this strand are reflected in the Complement as well as in the Reading Frames. *Editing a CDS (coding sequence) #A powerful feature of the Sequence editor is that it allows you to make new CDS (coding sequence) features on the nucleotide sequence. To make a new CDS feature, select the residues, and choose Features-->Coding Regions and Transcrips-->CDS. This action launches the CDS editor. The location of the highlighted sequenced will have been automatically filled out in the Location page. Visit the Location page, enter the protein name on the Coding Region-->Protein subpage, and press Accept. Select "Show Features" at the bottom of the Sequence Editor to see the CDS as a colored bar. The CDS can be selected by clicking either on it or on its name in the left margin. To remove a CDS, select it and click on Clear under the Sequin Edit menu. Click on yes when Sequin asks if you want to delete the associated protein product. #You can also have Sequin find coding sequences for you by using the ORF Finder, located under the Search menu of the record viewer. Click on ORF Finder to find the ORFs (open reading frames) in your sequence. The ORF Finder is described in more detail above. In the ORF Finder, click on the ORF you want to add the the sequence. This ORF will be highlighted on the sequence when it is viewed in the sequence editor. You can then make the sequence into a CDS by following the above instructions. Coding Region (CDS) feature form. At minimum, enter the name of the protein on the Protein subpage of the Coding Region page. For more detailed instructions, see the CDS feature, above. After you click Accept on the Coding Region form, Sequin will accept the CDS as a new feature, and the record viewer and other windows will be brought up to date. The color of the CDS will change to pink. A graphical representation of features can be seen by selecting the Graphic Display Format in the record viewer. #Saved CDS features can also be edited. You can alter the length or location of a saved CDS as described above. However, a saved CDS cannot be removed in the Sequence Editor window. To remove a saved feature, go the the Graphic Display Format of the record viewer, select the CDS, and choose Clear under the Edit window. #When you add or remove nucleotide sequence in a region within a CDS, you can choose whether the CDS should be interrupted by these changes. On the main Sequin window, select Split feature mode to have the CDS interrupted by the inserted or deleted sequence. Select Merge feature mode to have the CDS incorporate the changed sequence. *Working with sets of aligned sequences #Sequin allows you to work with aligned sets of closely related nucleotide sequences which are part of a population, phylogenetic, or mutation study. If the sequences are imported in a pre-aligned format, such as PHYLIP, Sequin uses this alignment. If the sequences are imported individually in FASTA format, Sequin can generate its own alignment. #You can view the aligned sequences in the Sequence Alignment Editor. In the record viewer, select All Sequences in the Target Sequences menu, and select the Alignment Display Format. Highlight the alignment by clicking inside of the box surrounding the sequence bars. Then select Edit alignment from the Edit menu. The aligned sequences can be viewed in a number of different formats. See instructions for the Sequence Editor Alignment menu, below. #If you imported a set of nucleotide sequences, you may want to add a CDS (coding sequence) feature to one or more of the sequences. You must first add the CDS feature to a single sequence (see Editing a CDS, above ). In order to access the Sequence Editor for a single sequence, double click on the name of that sequence in the Alignment view. You can then propagate the feature to other sequences ( see Feature Propagate under the Edit menu ). *Creating new alignments #Sequin also allows you to import sequences and align them either with an existing alignment or with a single sequence. Features can be propogated between aligned sequences. Sequences can either be in a file or in Entrez (see Sequence Editor File menu, below). *Sequence Editor File menu **Read Sequence File #Imports FASTA formatted sequence(s) or ASN1 records from a file. Three alignment methods are available. BLAST provides the best local alignment; BLAST with extensions provides a global alignment anchored by the BLAST local alignment; Global Alignment uses a dynamic programming algorithm to provide a different global alignment. **Download from Entrez #Imports one sequence from Entrez using the accession number or gi. **Import Alignment #Imports sequence alignments in Phylip, NEXUS, and FASTA+Gap format. The first sequence in the file have the identical sequence and Sequence Identifier as the sequence in the record. **Export #Exports single sequences in Text or FASTA format, and alignments in FASTA+Gap, Phylip, or ASN1 format. This function allows you to choose the range of the sequence to export. **Accept Changes #Closes the Sequence Editor, committing all changes made in the Sequence Editor. To save the changes, select File-->Save in the main Sequin menu. **Cancel #Cancels the Sequence Editor without committing any changes. *Sequence Editor Edit menu **Undo #Undoes all actions performed in the Sequence Editor since the last save. **Cut #Removes the highlighted sequence. This sequence can be pasted elsewhere. **Paste #Pastes a cut or copied sequence to the right of the cursor. **Copy #Copies the highlighted sequence. This sequence can be pasted elsewhere. **Refresh #Refreshes window by reloading the data. Note that this option does not undo any editing. **Delete Sequence #For alignments, deletes the selected sequence. *Sequence Editor View menu **View mode #Allows viewing of the sequence, only. **Edit mode #Allows editing of the sequence **Label #Allows you to change how the Sequence Identifiers are displayed. Normally, sequence identifiers are only displayed for aligned sequences. If the sequences have been downloaded from Entrez, and have different names in their definition lines, you can change which name you see. You can view each sequence labelled by the following names: FASTA short, FASTA long, Locus, Accession, or Report. **Font #Choose font **Preferences #Allows you to change the style of the display, including the colors, font type, and font size. **Complement #Shows the complement of the submitted strand underneath the original. **Reading frames #Shows the indicated phase translation of the selected coding sequence. You can select any or all of the six reading frames. **Translation Style #Allows you to choose between three styles in which to view the coding sequence translation. The default style is to see all amino acids. If you select the *** option, Sequin will display all methionine residue as M and all stop codons as *. If you select the orf option, Sequin will show all open reading frames by connecting the M and * in a single reading frame with a ~. **Find #The Find command allows you to find DNA or amino acid sequence patterns in your sequence. The search is case insensitive. To find an exact match to a DNA sequence pattern, type the pattern in the box. You can also specify non-exact patterns. To find the reverse complement of the pattern, click on the box. For example, #TCAGGGC finds the sequence TCAGGGC #[TCA]CAGGGC finds T or C or A followed by CAGGGC #NCAGGGC finds T or C or G or A followed by CAGGGC #TCA(3)GC finds the sequence TCAGGGC #TCA(1:3)GC finds the sequences TCAGC, TCAGGC, and TCAGGGC #TCA(1:3)NC finds the sequence TCA, followed by 1-3 occurrences of G,A,T,or C, followed by C, i.e., TCATC or TCATTC or TCAATGC #To find an exact match to an amino acid sequence pattern, type that sequence in the box, and click on "translate sequence". Sequin will look for all occurences of that pattern in all three plus strand open reading frames. The open reading frames will be shown, and the DNA sequence encoding that protein sequence will be highlighted. You can also specify non-exact patterns. For example, #CDLPEYC finds the sequence CDLPEYC #[CRQ]DLPEYC finds C or R or Q followed by DLPEYC #XDLPEYC finds any amino acid followed by DLPEYC #CDL(3)EYC finds the sequence CDLEEEYC #CDL(1:3)PE finds the sequences CDLPE, CDLPPE, and CDLPPPE #CDL(1:3)XE finds the sequence CDL, followed by 1-3 occurrences of any amino acid, followed by E, i.e., CDLAAE, CDLRSE, or CDLAPQE ***Find previous #Find the previous occurrence of a pattern. ***Find next #Find the next occurrence of a pattern. *Sequence Editor Features menu #the Features menu changes depending whether you are viewing a single sequence or a set of aligned sequences. #If you are viewing a single sequence, the menu contains a long list of all features that can be annotated on a sequence. These features are the same as those that are accessible through the main Sequin Annotate menu. #You can annotate features either in the Annotate menu or in the Sequence Editor. If you annotate them in the Annotate menu, you must provide the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you do not need to know their nucleotide coordinates. Simply highlight the sequence which the feature covers, and the location of the sequence will be automatically entered in the feature location box. Additional explanations of how to annotate features are provided in the section on Features. *Sequence Editor Alignment menu #Theses menu choices are only available when an alignment is being edited. Alignments can be generated when a set of sequences from a phylogenetic, population, or mutation study is submitted. They can also be made by importing additional reference sequences into Sequin with the Align with option under the Sequence Editor Edit menu. **Select Reference #Select which of the aligned sequences should be the master sequence. Click on the desired sequence in the sequence editor, then choose Select master to change the display. By default, the master sequence is the first sequence listed. The Sequence Identifier of the master sequence is indicated in color. **Select all #Select all nucleotide sequences. **Show substitutions/Show all #Changes the way the sequences are displayed. When Show all is selected (that is, Show substitutions is visible), the entire sequence of each entry is displayed. When Show substitutions is selected, the entire sequence of the master sequence is shown. The sequences of the aligned entries are shown as dots where they are identical to the master sequence, and letters where they are different. **Select Variations/Conservation #Use Select Variations to highlight positions at which the sequences are different from the Reference. Use Conservation to highlight positions that are different from the Reference. **Dot Matrix #This option shows the result of a dot matrix plot between two selected sequences in the alignment. It is under development. *Sequence Editor window buttons **Go to #Moves the cursor to the indicated location. **Look at #Moves the window to the indicated location without moving the cursor. **Merge feature mode/Split feature mode #In merge mode, any new sequence which is entered into a region spanned by an existing feature becomes part of that feature. For example, if you enter new sequence in the middle of a CDS, that sequence will be translated as part of the CDS. In split mode, the new sequence interrupts the feature. For example, if you enter new sequence in the middle of a CDS, the CDS will be interrupted by that sequence (see the location of the CDS in the record viewer). **Hide feat./Show feat. #This box toggles between hiding and showing the features on a sequence. To hide the features, click on the box when it is called Hide feat. To show features, click on the box when it is called Show feat. **Refresh #Refreshes the Sequence Editor window by reloading the data. This option does not undo any editing. **Accept #Closes the Sequence Editor after saving all of the changes made to sequences and features. **Cancel #Closes the Sequence Editor without saving any changes made to sequences or features.

Table of Contents


 

Questions or Comments?
Write to the NCBI Service Desk

Revised May 22, 2001